Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627348_at:

>probe:Drosophila_2:1627348_at:507:603; Interrogation_Position=282; Antisense; TGTTGGCATGAATCCAGGGCCCAAT
>probe:Drosophila_2:1627348_at:83:157; Interrogation_Position=318; Antisense; AACCGGAATTCCCTTTGGCAATGTG
>probe:Drosophila_2:1627348_at:287:263; Interrogation_Position=364; Antisense; CAGCTGGCTGGTTCGGTGGACCAAC
>probe:Drosophila_2:1627348_at:341:267; Interrogation_Position=413; Antisense; CAGTCGCTGGCTTGGATTGTCGGAT
>probe:Drosophila_2:1627348_at:660:81; Interrogation_Position=512; Antisense; AGTGTTTCGTCCACAATTTCTGTCC
>probe:Drosophila_2:1627348_at:297:279; Interrogation_Position=538; Antisense; CTAGCTTTCTTTGGCGCAGATGGCA
>probe:Drosophila_2:1627348_at:381:349; Interrogation_Position=560; Antisense; GCAGGAACATAACGCCCAGTGAAAT
>probe:Drosophila_2:1627348_at:391:239; Interrogation_Position=601; Antisense; AATCAGCTAGGAGACCTGTGCCTGC
>probe:Drosophila_2:1627348_at:507:201; Interrogation_Position=656; Antisense; AACCCGACGTGATTGTGGCCGTTGG
>probe:Drosophila_2:1627348_at:425:529; Interrogation_Position=680; Antisense; GGGAGTATGTTCACAGCGCACTGAA
>probe:Drosophila_2:1627348_at:632:165; Interrogation_Position=721; Antisense; AAATCCAATTGCGTTTCGGTGCTCC
>probe:Drosophila_2:1627348_at:238:45; Interrogation_Position=755; Antisense; ATCCTAGTCCGCGTTCTACTAATAA
>probe:Drosophila_2:1627348_at:6:577; Interrogation_Position=788; Antisense; GGCCCGAGAAGGCTCAAGCATTTTT
>probe:Drosophila_2:1627348_at:255:549; Interrogation_Position=813; Antisense; GGAGGAGCACAACCTAATCCGATTC

Paste this into a BLAST search page for me
TGTTGGCATGAATCCAGGGCCCAATAACCGGAATTCCCTTTGGCAATGTGCAGCTGGCTGGTTCGGTGGACCAACCAGTCGCTGGCTTGGATTGTCGGATAGTGTTTCGTCCACAATTTCTGTCCCTAGCTTTCTTTGGCGCAGATGGCAGCAGGAACATAACGCCCAGTGAAATAATCAGCTAGGAGACCTGTGCCTGCAACCCGACGTGATTGTGGCCGTTGGGGGAGTATGTTCACAGCGCACTGAAAAATCCAATTGCGTTTCGGTGCTCCATCCTAGTCCGCGTTCTACTAATAAGGCCCGAGAAGGCTCAAGCATTTTTGGAGGAGCACAACCTAATCCGATTC

Full Affymetrix probeset data:

Annotations for 1627348_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime