FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627349_at:

>probe:Drosophila_2:1627349_at:457:299; Interrogation_Position=179; Antisense; CGCGCGGCTTAAGGATCAGATTCGA
>probe:Drosophila_2:1627349_at:667:487; Interrogation_Position=308; Antisense; GTACCACATCGTTCTGGACACGAAC
>probe:Drosophila_2:1627349_at:63:585; Interrogation_Position=382; Antisense; TGGACTGTCTGTATGCCAAGTGCAT
>probe:Drosophila_2:1627349_at:535:219; Interrogation_Position=399; Antisense; AAGTGCATACCCTATATCTCCGACT
>probe:Drosophila_2:1627349_at:527:565; Interrogation_Position=450; Antisense; GGCAACAAGTACAAGCTGGCCCTGC
>probe:Drosophila_2:1627349_at:74:451; Interrogation_Position=486; Antisense; GATCCCAGATTCGAGCGACTGCCGT
>probe:Drosophila_2:1627349_at:541:357; Interrogation_Position=515; Antisense; GCACAAGGGCACCTATGCGGACGAT
>probe:Drosophila_2:1627349_at:276:681; Interrogation_Position=528; Antisense; TATGCGGACGATTGCCTCGTGGAGC
>probe:Drosophila_2:1627349_at:129:533; Interrogation_Position=553; Antisense; GGGTGCGCCAGCACAAATGCTACAT
>probe:Drosophila_2:1627349_at:342:231; Interrogation_Position=568; Antisense; AATGCTACATTGTGGCCACCAACGA
>probe:Drosophila_2:1627349_at:59:555; Interrogation_Position=596; Antisense; GGACCTTAAGAATCGCATCCGGAAG
>probe:Drosophila_2:1627349_at:526:307; Interrogation_Position=634; Antisense; CCATCATGTACGTGGCTGCGCATAA
>probe:Drosophila_2:1627349_at:245:465; Interrogation_Position=665; Antisense; GATTGAGCGTATGCCAGAAGCGTAT
>probe:Drosophila_2:1627349_at:226:589; Interrogation_Position=689; Antisense; TGGAGTCAAGGCGTAGACCTTTTTT

Paste this into a BLAST search page for me
CGCGCGGCTTAAGGATCAGATTCGAGTACCACATCGTTCTGGACACGAACTGGACTGTCTGTATGCCAAGTGCATAAGTGCATACCCTATATCTCCGACTGGCAACAAGTACAAGCTGGCCCTGCGATCCCAGATTCGAGCGACTGCCGTGCACAAGGGCACCTATGCGGACGATTATGCGGACGATTGCCTCGTGGAGCGGGTGCGCCAGCACAAATGCTACATAATGCTACATTGTGGCCACCAACGAGGACCTTAAGAATCGCATCCGGAAGCCATCATGTACGTGGCTGCGCATAAGATTGAGCGTATGCCAGAAGCGTATTGGAGTCAAGGCGTAGACCTTTTTT

Full Affymetrix probeset data:

Annotations for 1627349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720