FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627350_at:

>probe:Drosophila_2:1627350_at:633:227; Interrogation_Position=172; Antisense; AATGGCGGAGTCACGTCCCTGGAAA
>probe:Drosophila_2:1627350_at:109:173; Interrogation_Position=194; Antisense; AAAGACCTCTTTCTTGGCTGCGGAA
>probe:Drosophila_2:1627350_at:321:497; Interrogation_Position=248; Antisense; GTCATGTGGTCATCCAGGTGGCCAA
>probe:Drosophila_2:1627350_at:507:87; Interrogation_Position=313; Antisense; AGTCTGAATCTGACCAACCTGCTTA
>probe:Drosophila_2:1627350_at:97:203; Interrogation_Position=328; Antisense; AACCTGCTTATCATCATACTCCTGA
>probe:Drosophila_2:1627350_at:563:29; Interrogation_Position=355; Antisense; ATACTTATCTTCTCAGCCGGAATGC
>probe:Drosophila_2:1627350_at:278:503; Interrogation_Position=419; Antisense; GTCGCTCAGCCGGTCGTAGTGATAA
>probe:Drosophila_2:1627350_at:610:659; Interrogation_Position=441; Antisense; TAACTTCGGTTTGGGCATAGCTTCT
>probe:Drosophila_2:1627350_at:249:117; Interrogation_Position=459; Antisense; AGCTTCTGGCGATGACTATCTTATA
>probe:Drosophila_2:1627350_at:400:57; Interrogation_Position=518; Antisense; ATGAGTGCCTCTATGCAGCATCCTG
>probe:Drosophila_2:1627350_at:404:75; Interrogation_Position=579; Antisense; AGGACGTGCTCTTATGGGCGCCATT
>probe:Drosophila_2:1627350_at:164:523; Interrogation_Position=594; Antisense; GGGCGCCATTGAAGTTTTCCAAGGA
>probe:Drosophila_2:1627350_at:115:69; Interrogation_Position=680; Antisense; ATGGCTTCCGAGGAGTGGCCTGCAA
>probe:Drosophila_2:1627350_at:281:411; Interrogation_Position=708; Antisense; GACCCAGACCTGTGACGGATTGCTT

Paste this into a BLAST search page for me
AATGGCGGAGTCACGTCCCTGGAAAAAAGACCTCTTTCTTGGCTGCGGAAGTCATGTGGTCATCCAGGTGGCCAAAGTCTGAATCTGACCAACCTGCTTAAACCTGCTTATCATCATACTCCTGAATACTTATCTTCTCAGCCGGAATGCGTCGCTCAGCCGGTCGTAGTGATAATAACTTCGGTTTGGGCATAGCTTCTAGCTTCTGGCGATGACTATCTTATAATGAGTGCCTCTATGCAGCATCCTGAGGACGTGCTCTTATGGGCGCCATTGGGCGCCATTGAAGTTTTCCAAGGAATGGCTTCCGAGGAGTGGCCTGCAAGACCCAGACCTGTGACGGATTGCTT

Full Affymetrix probeset data:

Annotations for 1627350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720