Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627351_at:

>probe:Drosophila_2:1627351_at:599:637; Interrogation_Position=1881; Antisense; TCGTCATGGAGCTGGCTTGAGTCTG
>probe:Drosophila_2:1627351_at:423:113; Interrogation_Position=1951; Antisense; AGCAGCAGTCGATTGCATCGGGATC
>probe:Drosophila_2:1627351_at:223:527; Interrogation_Position=1970; Antisense; GGGATCGGGCCGAGATTTGCACCTC
>probe:Drosophila_2:1627351_at:124:97; Interrogation_Position=1982; Antisense; AGATTTGCACCTCGATGTTCTCATC
>probe:Drosophila_2:1627351_at:641:59; Interrogation_Position=1996; Antisense; ATGTTCTCATCCAGCAGCGAATCGG
>probe:Drosophila_2:1627351_at:541:719; Interrogation_Position=2050; Antisense; TTCCTGATGCCCTACTATCCGAATA
>probe:Drosophila_2:1627351_at:380:305; Interrogation_Position=2081; Antisense; CCTATGGCCGTGTCTACTAATTGAT
>probe:Drosophila_2:1627351_at:579:279; Interrogation_Position=2097; Antisense; CTAATTGATTGCGTGGCGGAGTTAT
>probe:Drosophila_2:1627351_at:217:429; Interrogation_Position=2115; Antisense; GAGTTATTTAGTGGAGGCGCCTCCC
>probe:Drosophila_2:1627351_at:244:575; Interrogation_Position=2130; Antisense; GGCGCCTCCCAGAGACTGACGGAAT
>probe:Drosophila_2:1627351_at:198:207; Interrogation_Position=2152; Antisense; AATCGTCTAACGAGTGGTACACCAA
>probe:Drosophila_2:1627351_at:571:289; Interrogation_Position=2204; Antisense; GCGTAGTTCTGTAACTTTTCGGTTG
>probe:Drosophila_2:1627351_at:444:719; Interrogation_Position=2242; Antisense; TTGAAAGCGTTTTGCAAGCGGTTTG
>probe:Drosophila_2:1627351_at:658:725; Interrogation_Position=2282; Antisense; TTGATATCCTTTCGCTGTAGCTGTA

Paste this into a BLAST search page for me
TCGTCATGGAGCTGGCTTGAGTCTGAGCAGCAGTCGATTGCATCGGGATCGGGATCGGGCCGAGATTTGCACCTCAGATTTGCACCTCGATGTTCTCATCATGTTCTCATCCAGCAGCGAATCGGTTCCTGATGCCCTACTATCCGAATACCTATGGCCGTGTCTACTAATTGATCTAATTGATTGCGTGGCGGAGTTATGAGTTATTTAGTGGAGGCGCCTCCCGGCGCCTCCCAGAGACTGACGGAATAATCGTCTAACGAGTGGTACACCAAGCGTAGTTCTGTAACTTTTCGGTTGTTGAAAGCGTTTTGCAAGCGGTTTGTTGATATCCTTTCGCTGTAGCTGTA

Full Affymetrix probeset data:

Annotations for 1627351_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime