FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627352_at:

>probe:Drosophila_2:1627352_at:290:407; Interrogation_Position=1035; Antisense; GAGCACGGATCCACCTACGGAGGCA
>probe:Drosophila_2:1627352_at:416:269; Interrogation_Position=1082; Antisense; CATGGCCGCCTTGGAGGTTCTGCAG
>probe:Drosophila_2:1627352_at:306:185; Interrogation_Position=1134; Antisense; AAAATGGGTGACCTGCTGCGCAACG
>probe:Drosophila_2:1627352_at:535:393; Interrogation_Position=1201; Antisense; GAAAGGGTCTGCTCAACGCCATCGT
>probe:Drosophila_2:1627352_at:672:715; Interrogation_Position=1239; Antisense; TTCGATGCCTGGGAGGTGTGCCTCA
>probe:Drosophila_2:1627352_at:675:67; Interrogation_Position=1300; Antisense; ATGGCGACATTATTCGCTTCGCTCC
>probe:Drosophila_2:1627352_at:384:337; Interrogation_Position=1320; Antisense; GCTCCTCCACTGGTCATCAATGAGA
>probe:Drosophila_2:1627352_at:553:231; Interrogation_Position=1338; Antisense; AATGAGACCCAAATGCGCGAGAGCA
>probe:Drosophila_2:1627352_at:418:387; Interrogation_Position=1376; Antisense; GAAAACCATTCTGTCCATGTAGATT
>probe:Drosophila_2:1627352_at:197:497; Interrogation_Position=1406; Antisense; GTCAGTGGAGCACCGCTCATGTATA
>probe:Drosophila_2:1627352_at:343:115; Interrogation_Position=925; Antisense; AGCAGGTGCAGCCAGACATTCTGAT
>probe:Drosophila_2:1627352_at:514:449; Interrogation_Position=947; Antisense; GATCCTGGGAAAAGCACTGTCCGGA
>probe:Drosophila_2:1627352_at:275:283; Interrogation_Position=963; Antisense; CTGTCCGGAGGAATGTATCCCGTGT
>probe:Drosophila_2:1627352_at:572:539; Interrogation_Position=992; Antisense; GGTTCTCTGCAACGACCAGGTGATG

Paste this into a BLAST search page for me
GAGCACGGATCCACCTACGGAGGCACATGGCCGCCTTGGAGGTTCTGCAGAAAATGGGTGACCTGCTGCGCAACGGAAAGGGTCTGCTCAACGCCATCGTTTCGATGCCTGGGAGGTGTGCCTCAATGGCGACATTATTCGCTTCGCTCCGCTCCTCCACTGGTCATCAATGAGAAATGAGACCCAAATGCGCGAGAGCAGAAAACCATTCTGTCCATGTAGATTGTCAGTGGAGCACCGCTCATGTATAAGCAGGTGCAGCCAGACATTCTGATGATCCTGGGAAAAGCACTGTCCGGACTGTCCGGAGGAATGTATCCCGTGTGGTTCTCTGCAACGACCAGGTGATG

Full Affymetrix probeset data:

Annotations for 1627352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720