FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627353_at:

>probe:Drosophila_2:1627353_at:673:709; Interrogation_Position=1120; Antisense; TTAACCACTTTGTTGGTGGCCTCTG
>probe:Drosophila_2:1627353_at:216:443; Interrogation_Position=1174; Antisense; GATGTCACCTACGAAGCGTTGTCCA
>probe:Drosophila_2:1627353_at:72:315; Interrogation_Position=1189; Antisense; GCGTTGTCCAAGTCGGTTCAGGGCA
>probe:Drosophila_2:1627353_at:272:237; Interrogation_Position=639; Antisense; AATCGCTTGGCGTCAAAGGAGGCTA
>probe:Drosophila_2:1627353_at:472:121; Interrogation_Position=677; Antisense; AGCGGGAACTAACTCATTTGCACAG
>probe:Drosophila_2:1627353_at:673:87; Interrogation_Position=700; Antisense; AGTCCCCGAATATCAGAGGTCCAGA
>probe:Drosophila_2:1627353_at:381:611; Interrogation_Position=770; Antisense; TGAACCGGACGTTTCAGTACTCCAT
>probe:Drosophila_2:1627353_at:485:619; Interrogation_Position=800; Antisense; TGCTCTTCGTGGGATGTTTCCTGAA
>probe:Drosophila_2:1627353_at:232:471; Interrogation_Position=840; Antisense; GTTCCTCGTCTATCAGGGCATTGAG
>probe:Drosophila_2:1627353_at:414:525; Interrogation_Position=855; Antisense; GGGCATTGAGAATCCTTCCATGGCC
>probe:Drosophila_2:1627353_at:438:69; Interrogation_Position=874; Antisense; ATGGCCGACTTCACCAAGTGGGTAT
>probe:Drosophila_2:1627353_at:413:221; Interrogation_Position=889; Antisense; AAGTGGGTATGCATGCTTCTCTGGC
>probe:Drosophila_2:1627353_at:483:641; Interrogation_Position=908; Antisense; TCTGGCTGGCCATGCACGTGGGAAA
>probe:Drosophila_2:1627353_at:276:9; Interrogation_Position=977; Antisense; ATTCCACGTGCTTGACCTTATTGAG

Paste this into a BLAST search page for me
TTAACCACTTTGTTGGTGGCCTCTGGATGTCACCTACGAAGCGTTGTCCAGCGTTGTCCAAGTCGGTTCAGGGCAAATCGCTTGGCGTCAAAGGAGGCTAAGCGGGAACTAACTCATTTGCACAGAGTCCCCGAATATCAGAGGTCCAGATGAACCGGACGTTTCAGTACTCCATTGCTCTTCGTGGGATGTTTCCTGAAGTTCCTCGTCTATCAGGGCATTGAGGGGCATTGAGAATCCTTCCATGGCCATGGCCGACTTCACCAAGTGGGTATAAGTGGGTATGCATGCTTCTCTGGCTCTGGCTGGCCATGCACGTGGGAAAATTCCACGTGCTTGACCTTATTGAG

Full Affymetrix probeset data:

Annotations for 1627353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720