FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627354_at:

>probe:Drosophila_2:1627354_at:310:539; Interrogation_Position=1008; Antisense; GGTTTCGGTTTAAAGTGCACACTCA
>probe:Drosophila_2:1627354_at:80:585; Interrogation_Position=1061; Antisense; TGGCAATTCATTGCAGCCTCAGCTA
>probe:Drosophila_2:1627354_at:405:509; Interrogation_Position=1105; Antisense; GTGCTCAATCGTCTAATGTATGCCA
>probe:Drosophila_2:1627354_at:418:207; Interrogation_Position=1144; Antisense; AAGCTGAAAAGCATTCCGCTTCCCA
>probe:Drosophila_2:1627354_at:516:313; Interrogation_Position=1161; Antisense; GCTTCCCAATTACACTCTAATGGCG
>probe:Drosophila_2:1627354_at:330:465; Interrogation_Position=1185; Antisense; GTTGCTAAAGGTCACGCCGATTTCT
>probe:Drosophila_2:1627354_at:577:317; Interrogation_Position=1200; Antisense; GCCGATTTCTAACAGCGCAGTTGAC
>probe:Drosophila_2:1627354_at:461:427; Interrogation_Position=1264; Antisense; GAGATTCTTTTGTACGTCCTTGCAC
>probe:Drosophila_2:1627354_at:245:25; Interrogation_Position=1300; Antisense; ATAGAACCCACGTTGCTAATCGATA
>probe:Drosophila_2:1627354_at:564:583; Interrogation_Position=830; Antisense; TGGAATGCGCGAACGACTGGTCAAT
>probe:Drosophila_2:1627354_at:603:499; Interrogation_Position=891; Antisense; GTCGATTATCAGGTCTATGCGCCAA
>probe:Drosophila_2:1627354_at:89:239; Interrogation_Position=939; Antisense; GCGTAGTCCGTTTCGAAATCTGGTC
>probe:Drosophila_2:1627354_at:710:715; Interrogation_Position=972; Antisense; TTCGATCCGATACGACGGTGGGCTT
>probe:Drosophila_2:1627354_at:646:517; Interrogation_Position=989; Antisense; GTGGGCTTCAATTGGACCTGGTTTC

Paste this into a BLAST search page for me
GGTTTCGGTTTAAAGTGCACACTCATGGCAATTCATTGCAGCCTCAGCTAGTGCTCAATCGTCTAATGTATGCCAAAGCTGAAAAGCATTCCGCTTCCCAGCTTCCCAATTACACTCTAATGGCGGTTGCTAAAGGTCACGCCGATTTCTGCCGATTTCTAACAGCGCAGTTGACGAGATTCTTTTGTACGTCCTTGCACATAGAACCCACGTTGCTAATCGATATGGAATGCGCGAACGACTGGTCAATGTCGATTATCAGGTCTATGCGCCAAGCGTAGTCCGTTTCGAAATCTGGTCTTCGATCCGATACGACGGTGGGCTTGTGGGCTTCAATTGGACCTGGTTTC

Full Affymetrix probeset data:

Annotations for 1627354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720