FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627359_at:

>probe:Drosophila_2:1627359_at:511:3; Interrogation_Position=1350; Antisense; ATTGGACAACTATGCCGAGGCGTTT
>probe:Drosophila_2:1627359_at:406:405; Interrogation_Position=1393; Antisense; GACTCGTTTGTAATAGCTCCACTGC
>probe:Drosophila_2:1627359_at:107:79; Interrogation_Position=1437; Antisense; AGGATACCTACAGTTACGCTCTGCA
>probe:Drosophila_2:1627359_at:452:135; Interrogation_Position=1452; Antisense; ACGCTCTGCAGATCCTAAAGTTCAT
>probe:Drosophila_2:1627359_at:282:663; Interrogation_Position=1467; Antisense; TAAAGTTCATCCTCTAATCCATGCC
>probe:Drosophila_2:1627359_at:324:683; Interrogation_Position=1498; Antisense; TATGACGATCCGCACGATATGGCCG
>probe:Drosophila_2:1627359_at:176:177; Interrogation_Position=1562; Antisense; AAACGCCGGTGATGCAATCCCTGAA
>probe:Drosophila_2:1627359_at:367:373; Interrogation_Position=1624; Antisense; GAAGTGGAATACCTCAGCGATGCCT
>probe:Drosophila_2:1627359_at:240:581; Interrogation_Position=1661; Antisense; TGGCCAGATTTTACTCGCAGACGAT
>probe:Drosophila_2:1627359_at:172:137; Interrogation_Position=1681; Antisense; ACGATCTATCATCCGGTGGGCACAT
>probe:Drosophila_2:1627359_at:319:567; Interrogation_Position=1699; Antisense; GGCACATGCAAAATGGCTCCAGCTT
>probe:Drosophila_2:1627359_at:299:49; Interrogation_Position=1790; Antisense; ATGCCAGTATAATGCCCACTATTCC
>probe:Drosophila_2:1627359_at:170:369; Interrogation_Position=1827; Antisense; GAATGCTCCGACTCTAATGCTGGCG
>probe:Drosophila_2:1627359_at:256:37; Interrogation_Position=1867; Antisense; ATCATCAAGGAGGACTGGCGCCACT

Paste this into a BLAST search page for me
ATTGGACAACTATGCCGAGGCGTTTGACTCGTTTGTAATAGCTCCACTGCAGGATACCTACAGTTACGCTCTGCAACGCTCTGCAGATCCTAAAGTTCATTAAAGTTCATCCTCTAATCCATGCCTATGACGATCCGCACGATATGGCCGAAACGCCGGTGATGCAATCCCTGAAGAAGTGGAATACCTCAGCGATGCCTTGGCCAGATTTTACTCGCAGACGATACGATCTATCATCCGGTGGGCACATGGCACATGCAAAATGGCTCCAGCTTATGCCAGTATAATGCCCACTATTCCGAATGCTCCGACTCTAATGCTGGCGATCATCAAGGAGGACTGGCGCCACT

Full Affymetrix probeset data:

Annotations for 1627359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720