Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627364_s_at:

>probe:Drosophila_2:1627364_s_at:129:161; Interrogation_Position=213; Antisense; ACAAGCGTCAGGCTGTTCTGTGCAT
>probe:Drosophila_2:1627364_s_at:593:713; Interrogation_Position=228; Antisense; TTCTGTGCATCCTAGCCGAGTCCTT
>probe:Drosophila_2:1627364_s_at:119:717; Interrogation_Position=251; Antisense; TTCGACGAGCCCAACTACAAGAAGC
>probe:Drosophila_2:1627364_s_at:532:663; Interrogation_Position=266; Antisense; TACAAGAAGCTGGTTACCGCCCTGT
>probe:Drosophila_2:1627364_s_at:604:589; Interrogation_Position=276; Antisense; TGGTTACCGCCCTGTGCAACGAGCA
>probe:Drosophila_2:1627364_s_at:436:705; Interrogation_Position=312; Antisense; TTATCCGCGTGGACTCGCACAAGAA
>probe:Drosophila_2:1627364_s_at:384:227; Interrogation_Position=345; Antisense; AATGGTCCGGTCTGTGCAAGATCGA
>probe:Drosophila_2:1627364_s_at:268:621; Interrogation_Position=401; Antisense; TGCTCCGTGGTCGTGATCAAGGATT
>probe:Drosophila_2:1627364_s_at:706:459; Interrogation_Position=422; Antisense; GATTTCGGTGAGGAGACACCCGCTT
>probe:Drosophila_2:1627364_s_at:471:397; Interrogation_Position=436; Antisense; GACACCCGCTTTGGACGTGGTTAAG
>probe:Drosophila_2:1627364_s_at:305:539; Interrogation_Position=454; Antisense; GGTTAAGGACCATCTCAGGCAGAAC
>probe:Drosophila_2:1627364_s_at:441:355; Interrogation_Position=493; Antisense; GCACTGCCTGCTGAATGAGAGACTA
>probe:Drosophila_2:1627364_s_at:328:391; Interrogation_Position=521; Antisense; GAAAGTTCTTTTTAAGCTATTCGCT
>probe:Drosophila_2:1627364_s_at:370:177; Interrogation_Position=557; Antisense; AAACGTATTGAACCTGAATCCAGAT

Paste this into a BLAST search page for me
ACAAGCGTCAGGCTGTTCTGTGCATTTCTGTGCATCCTAGCCGAGTCCTTTTCGACGAGCCCAACTACAAGAAGCTACAAGAAGCTGGTTACCGCCCTGTTGGTTACCGCCCTGTGCAACGAGCATTATCCGCGTGGACTCGCACAAGAAAATGGTCCGGTCTGTGCAAGATCGATGCTCCGTGGTCGTGATCAAGGATTGATTTCGGTGAGGAGACACCCGCTTGACACCCGCTTTGGACGTGGTTAAGGGTTAAGGACCATCTCAGGCAGAACGCACTGCCTGCTGAATGAGAGACTAGAAAGTTCTTTTTAAGCTATTCGCTAAACGTATTGAACCTGAATCCAGAT

Full Affymetrix probeset data:

Annotations for 1627364_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime