FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627367_at:

>probe:Drosophila_2:1627367_at:43:601; Interrogation_Position=1038; Antisense; TGTACACATGATCACTTGTCAGCCC
>probe:Drosophila_2:1627367_at:17:305; Interrogation_Position=1062; Antisense; CCGAATGTTGATGGCCTGGGTGAAT
>probe:Drosophila_2:1627367_at:203:153; Interrogation_Position=1103; Antisense; ACATGGAGACCCTGTCCGATGAGAA
>probe:Drosophila_2:1627367_at:99:433; Interrogation_Position=1135; Antisense; GAGGGCTTGTACTGGCTTTTCCGAA
>probe:Drosophila_2:1627367_at:101:353; Interrogation_Position=1202; Antisense; GCAGCTCGTGGTTTTCGAATCCGAA
>probe:Drosophila_2:1627367_at:676:367; Interrogation_Position=1218; Antisense; GAATCCGAATTTCCGTGGCAGTTGG
>probe:Drosophila_2:1627367_at:577:157; Interrogation_Position=1273; Antisense; AATACGGGCCCCTGGGATCTAGAGT
>probe:Drosophila_2:1627367_at:433:677; Interrogation_Position=1292; Antisense; TAGAGTCTCCTGTGTTGGGCGAAGA
>probe:Drosophila_2:1627367_at:370:375; Interrogation_Position=1312; Antisense; GAAGATGGTCATTTAGGCCTCCTTT
>probe:Drosophila_2:1627367_at:141:373; Interrogation_Position=1345; Antisense; GAAGCGTCTAGCAGGAATCACTTTT
>probe:Drosophila_2:1627367_at:698:71; Interrogation_Position=1406; Antisense; AGGCAGACCGGCTCATTGATCATTA
>probe:Drosophila_2:1627367_at:243:127; Interrogation_Position=1432; Antisense; ACCTCATGCAGTGTCAGTGCCTGAA
>probe:Drosophila_2:1627367_at:647:55; Interrogation_Position=926; Antisense; ATGAGAAGCAACCTCTTCCTGACGG
>probe:Drosophila_2:1627367_at:203:529; Interrogation_Position=957; Antisense; GGGTTTCTTCTGCTTTTGGCTGGAA

Paste this into a BLAST search page for me
TGTACACATGATCACTTGTCAGCCCCCGAATGTTGATGGCCTGGGTGAATACATGGAGACCCTGTCCGATGAGAAGAGGGCTTGTACTGGCTTTTCCGAAGCAGCTCGTGGTTTTCGAATCCGAAGAATCCGAATTTCCGTGGCAGTTGGAATACGGGCCCCTGGGATCTAGAGTTAGAGTCTCCTGTGTTGGGCGAAGAGAAGATGGTCATTTAGGCCTCCTTTGAAGCGTCTAGCAGGAATCACTTTTAGGCAGACCGGCTCATTGATCATTAACCTCATGCAGTGTCAGTGCCTGAAATGAGAAGCAACCTCTTCCTGACGGGGGTTTCTTCTGCTTTTGGCTGGAA

Full Affymetrix probeset data:

Annotations for 1627367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720