FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627368_at:

>probe:Drosophila_2:1627368_at:506:657; Interrogation_Position=203; Antisense; TAAGGGCCTACTTCACAACAGGTGT
>probe:Drosophila_2:1627368_at:319:81; Interrogation_Position=222; Antisense; AGGTGTGCCCGACTACAACATCAAG
>probe:Drosophila_2:1627368_at:321:363; Interrogation_Position=292; Antisense; GAATCACAGGGTCTGGGCAGCTTTC
>probe:Drosophila_2:1627368_at:646:567; Interrogation_Position=307; Antisense; GGCAGCTTTCGTCTGATATTGCGCA
>probe:Drosophila_2:1627368_at:59:691; Interrogation_Position=323; Antisense; TATTGCGCAATGTATCCGAGTACGG
>probe:Drosophila_2:1627368_at:327:435; Interrogation_Position=361; Antisense; GAGGTGACCAAGTTCCATGCCGATC
>probe:Drosophila_2:1627368_at:519:123; Interrogation_Position=395; Antisense; AGCGCATCGTCTACACTCAGTATTT
>probe:Drosophila_2:1627368_at:406:429; Interrogation_Position=448; Antisense; GAGTTCGCCGCCAAGATGCTGGGTA
>probe:Drosophila_2:1627368_at:537:461; Interrogation_Position=514; Antisense; GATTACAGTCAAACCACCAGCGTTA
>probe:Drosophila_2:1627368_at:352:571; Interrogation_Position=556; Antisense; GGCTCACTCATCAAGGTCCATGTGG
>probe:Drosophila_2:1627368_at:486:549; Interrogation_Position=658; Antisense; GGAGTCATCAACAGCATGTGGCAGC
>probe:Drosophila_2:1627368_at:427:593; Interrogation_Position=683; Antisense; TGGGATTGCCCTTCATCAAGCCGAT
>probe:Drosophila_2:1627368_at:412:137; Interrogation_Position=713; Antisense; ACGAGTTGGTTAGCACGGCATTTAC
>probe:Drosophila_2:1627368_at:298:459; Interrogation_Position=739; Antisense; GATATATTCAACGAGTCCTTCCGGC

Paste this into a BLAST search page for me
TAAGGGCCTACTTCACAACAGGTGTAGGTGTGCCCGACTACAACATCAAGGAATCACAGGGTCTGGGCAGCTTTCGGCAGCTTTCGTCTGATATTGCGCATATTGCGCAATGTATCCGAGTACGGGAGGTGACCAAGTTCCATGCCGATCAGCGCATCGTCTACACTCAGTATTTGAGTTCGCCGCCAAGATGCTGGGTAGATTACAGTCAAACCACCAGCGTTAGGCTCACTCATCAAGGTCCATGTGGGGAGTCATCAACAGCATGTGGCAGCTGGGATTGCCCTTCATCAAGCCGATACGAGTTGGTTAGCACGGCATTTACGATATATTCAACGAGTCCTTCCGGC

Full Affymetrix probeset data:

Annotations for 1627368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720