FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627370_at:

>probe:Drosophila_2:1627370_at:108:617; Interrogation_Position=127; Antisense; TGCAAAGTGCGTTCGCGATTCCGAT
>probe:Drosophila_2:1627370_at:622:623; Interrogation_Position=152; Antisense; TGCGATTCCGATTGCCAGTGATATG
>probe:Drosophila_2:1627370_at:577:267; Interrogation_Position=167; Antisense; CAGTGATATGTCGACGGCCCTGGTT
>probe:Drosophila_2:1627370_at:574:141; Interrogation_Position=180; Antisense; ACGGCCCTGGTTTATTGGCAGTCAA
>probe:Drosophila_2:1627370_at:165:613; Interrogation_Position=205; Antisense; TGAATGGCGGCGATCCGGTTGACAA
>probe:Drosophila_2:1627370_at:101:227; Interrogation_Position=228; Antisense; AAGGCCACCGCGGATTGGGCGCCAT
>probe:Drosophila_2:1627370_at:475:521; Interrogation_Position=274; Antisense; GTGGCAGCTTCAGTAGCAGCATCAT
>probe:Drosophila_2:1627370_at:686:647; Interrogation_Position=356; Antisense; TCATCCGCCTCATTACATCAATTAT
>probe:Drosophila_2:1627370_at:58:705; Interrogation_Position=377; Antisense; TTATTTGGCGCAAATTGGCTGCCAG
>probe:Drosophila_2:1627370_at:462:583; Interrogation_Position=392; Antisense; TGGCTGCCAGCATCGTGTCAGAAAT
>probe:Drosophila_2:1627370_at:154:57; Interrogation_Position=448; Antisense; ATGACGACGACGCTGGCCATCAGAT
>probe:Drosophila_2:1627370_at:411:97; Interrogation_Position=469; Antisense; AGATCATCTCTAAATTCCTGCCCAA
>probe:Drosophila_2:1627370_at:684:183; Interrogation_Position=492; Antisense; AAAAGTGCCTGGGACACGGTGCTGT
>probe:Drosophila_2:1627370_at:405:331; Interrogation_Position=624; Antisense; GCGGAACGGGCACTCTATTATACTA

Paste this into a BLAST search page for me
TGCAAAGTGCGTTCGCGATTCCGATTGCGATTCCGATTGCCAGTGATATGCAGTGATATGTCGACGGCCCTGGTTACGGCCCTGGTTTATTGGCAGTCAATGAATGGCGGCGATCCGGTTGACAAAAGGCCACCGCGGATTGGGCGCCATGTGGCAGCTTCAGTAGCAGCATCATTCATCCGCCTCATTACATCAATTATTTATTTGGCGCAAATTGGCTGCCAGTGGCTGCCAGCATCGTGTCAGAAATATGACGACGACGCTGGCCATCAGATAGATCATCTCTAAATTCCTGCCCAAAAAAGTGCCTGGGACACGGTGCTGTGCGGAACGGGCACTCTATTATACTA

Full Affymetrix probeset data:

Annotations for 1627370_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720