FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627371_at:

>probe:Drosophila_2:1627371_at:684:101; Interrogation_Position=4183; Antisense; AGAGCACACTTCAAATCCTTGCCGA
>probe:Drosophila_2:1627371_at:450:275; Interrogation_Position=4200; Antisense; CTTGCCGAGGATTTCAGTCAGGATG
>probe:Drosophila_2:1627371_at:496:713; Interrogation_Position=4212; Antisense; TTCAGTCAGGATGTGCGATTGCTCG
>probe:Drosophila_2:1627371_at:609:399; Interrogation_Position=4285; Antisense; GACAGTACGAGGATCTACCGATGGA
>probe:Drosophila_2:1627371_at:233:87; Interrogation_Position=4331; Antisense; AGTGCGTGATGAATTGCTCCTGGAT
>probe:Drosophila_2:1627371_at:686:7; Interrogation_Position=4343; Antisense; ATTGCTCCTGGATCTGGTTTATCTC
>probe:Drosophila_2:1627371_at:611:539; Interrogation_Position=4358; Antisense; GGTTTATCTCCAGAAGATGGCCGAA
>probe:Drosophila_2:1627371_at:670:99; Interrogation_Position=4372; Antisense; AGATGGCCGAATCCGCAGAGCGCAA
>probe:Drosophila_2:1627371_at:122:415; Interrogation_Position=4389; Antisense; GAGCGCAATCAACGTAACGCCCGTT
>probe:Drosophila_2:1627371_at:476:549; Interrogation_Position=4418; Antisense; GGAGGTGCTCAAACAGACCAGCCTG
>probe:Drosophila_2:1627371_at:122:259; Interrogation_Position=4469; Antisense; CACCGAGTACTCACCGCGTTTTATA
>probe:Drosophila_2:1627371_at:133:177; Interrogation_Position=4494; Antisense; AAACTGCTAAAGACGGCGGAGCTTT
>probe:Drosophila_2:1627371_at:365:345; Interrogation_Position=4538; Antisense; GCAGGCCAAGGCATTTGTGGGTCTT
>probe:Drosophila_2:1627371_at:355:495; Interrogation_Position=4558; Antisense; GTCTTTAGACCGCTTTAATCAACGT

Paste this into a BLAST search page for me
AGAGCACACTTCAAATCCTTGCCGACTTGCCGAGGATTTCAGTCAGGATGTTCAGTCAGGATGTGCGATTGCTCGGACAGTACGAGGATCTACCGATGGAAGTGCGTGATGAATTGCTCCTGGATATTGCTCCTGGATCTGGTTTATCTCGGTTTATCTCCAGAAGATGGCCGAAAGATGGCCGAATCCGCAGAGCGCAAGAGCGCAATCAACGTAACGCCCGTTGGAGGTGCTCAAACAGACCAGCCTGCACCGAGTACTCACCGCGTTTTATAAAACTGCTAAAGACGGCGGAGCTTTGCAGGCCAAGGCATTTGTGGGTCTTGTCTTTAGACCGCTTTAATCAACGT

Full Affymetrix probeset data:

Annotations for 1627371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720