FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627373_at:

>probe:Drosophila_2:1627373_at:260:173; Interrogation_Position=1007; Antisense; AAAGCAGTGCGTTGTTTGTATTCTA
>probe:Drosophila_2:1627373_at:262:331; Interrogation_Position=1062; Antisense; GCGGATTCTATATTCCGCTTAGAAT
>probe:Drosophila_2:1627373_at:423:653; Interrogation_Position=1093; Antisense; TAATCTACACTAAGCTCGACCTAAG
>probe:Drosophila_2:1627373_at:692:633; Interrogation_Position=1108; Antisense; TCGACCTAAGCCACAAATTTTCTGT
>probe:Drosophila_2:1627373_at:686:675; Interrogation_Position=651; Antisense; TAGTTGCTACAACGGCGAGAGTGAC
>probe:Drosophila_2:1627373_at:39:145; Interrogation_Position=678; Antisense; ACTGAATCTTGAAGGATGCCGGCAA
>probe:Drosophila_2:1627373_at:559:401; Interrogation_Position=712; Antisense; GACTTTATCGCCGATCGTTGGACGA
>probe:Drosophila_2:1627373_at:276:403; Interrogation_Position=732; Antisense; GACGACATTTAATCTGGTTTCCCTG
>probe:Drosophila_2:1627373_at:323:237; Interrogation_Position=742; Antisense; AATCTGGTTTCCCTGGTGCTATTGG
>probe:Drosophila_2:1627373_at:453:517; Interrogation_Position=767; Antisense; GTGTGGAGCTGATTTGCGCCCTGTT
>probe:Drosophila_2:1627373_at:637:241; Interrogation_Position=808; Antisense; AATAGCATCGTGAACCGCTGGCGAC
>probe:Drosophila_2:1627373_at:31:577; Interrogation_Position=827; Antisense; GGCGACGCTCGAAGTACTATCAGAA
>probe:Drosophila_2:1627373_at:354:659; Interrogation_Position=907; Antisense; TAAGCTGCGCATACTTAAGGCCAAA
>probe:Drosophila_2:1627373_at:512:657; Interrogation_Position=922; Antisense; TAAGGCCAAAGAACTCTCCATACAA

Paste this into a BLAST search page for me
AAAGCAGTGCGTTGTTTGTATTCTAGCGGATTCTATATTCCGCTTAGAATTAATCTACACTAAGCTCGACCTAAGTCGACCTAAGCCACAAATTTTCTGTTAGTTGCTACAACGGCGAGAGTGACACTGAATCTTGAAGGATGCCGGCAAGACTTTATCGCCGATCGTTGGACGAGACGACATTTAATCTGGTTTCCCTGAATCTGGTTTCCCTGGTGCTATTGGGTGTGGAGCTGATTTGCGCCCTGTTAATAGCATCGTGAACCGCTGGCGACGGCGACGCTCGAAGTACTATCAGAATAAGCTGCGCATACTTAAGGCCAAATAAGGCCAAAGAACTCTCCATACAA

Full Affymetrix probeset data:

Annotations for 1627373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720