FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627376_at:

>probe:Drosophila_2:1627376_at:235:57; Interrogation_Position=2941; Antisense; ATGACCGGGTGGTCCAGCTGCTGAA
>probe:Drosophila_2:1627376_at:581:383; Interrogation_Position=2988; Antisense; GAACTGGCCATGACCTGGATTCCAT
>probe:Drosophila_2:1627376_at:360:427; Interrogation_Position=3027; Antisense; GAGATCGATTCATCGTCGGACGAAA
>probe:Drosophila_2:1627376_at:680:51; Interrogation_Position=3058; Antisense; ATGCTGGTCAGCTGGAGATCAAGTC
>probe:Drosophila_2:1627376_at:203:435; Interrogation_Position=3111; Antisense; GAGGATTCCGTGGAGTTGGACCTAA
>probe:Drosophila_2:1627376_at:509:445; Interrogation_Position=3159; Antisense; GATGAATCCAGTAGAGACACCGAAA
>probe:Drosophila_2:1627376_at:139:163; Interrogation_Position=3219; Antisense; AAATTCATTTACGACCGGCTCTGTT
>probe:Drosophila_2:1627376_at:172:365; Interrogation_Position=3251; Antisense; GAATCAGCCTTTGGGACATGGGTCC
>probe:Drosophila_2:1627376_at:186:395; Interrogation_Position=3290; Antisense; GAAATGGATGCAACTAGCCCGCCAG
>probe:Drosophila_2:1627376_at:525:377; Interrogation_Position=3323; Antisense; GAAGCAGTTCGCCTTTATATGGCTG
>probe:Drosophila_2:1627376_at:98:225; Interrogation_Position=3382; Antisense; AAGGAGCCTCTGTAGAGTTTTCCAC
>probe:Drosophila_2:1627376_at:694:97; Interrogation_Position=3395; Antisense; AGAGTTTTCCACATTTGCTCGTGCC
>probe:Drosophila_2:1627376_at:630:83; Interrogation_Position=3428; Antisense; AGTGGATCCACAGGCTTACGCCCTA
>probe:Drosophila_2:1627376_at:569:299; Interrogation_Position=3447; Antisense; GCCCTACTGGTTAACCCAACTTGAT

Paste this into a BLAST search page for me
ATGACCGGGTGGTCCAGCTGCTGAAGAACTGGCCATGACCTGGATTCCATGAGATCGATTCATCGTCGGACGAAAATGCTGGTCAGCTGGAGATCAAGTCGAGGATTCCGTGGAGTTGGACCTAAGATGAATCCAGTAGAGACACCGAAAAAATTCATTTACGACCGGCTCTGTTGAATCAGCCTTTGGGACATGGGTCCGAAATGGATGCAACTAGCCCGCCAGGAAGCAGTTCGCCTTTATATGGCTGAAGGAGCCTCTGTAGAGTTTTCCACAGAGTTTTCCACATTTGCTCGTGCCAGTGGATCCACAGGCTTACGCCCTAGCCCTACTGGTTAACCCAACTTGAT

Full Affymetrix probeset data:

Annotations for 1627376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720