Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627377_at:

>probe:Drosophila_2:1627377_at:714:571; Interrogation_Position=1673; Antisense; GGCTCACACTGTATTTCTGGCAAAT
>probe:Drosophila_2:1627377_at:230:567; Interrogation_Position=1691; Antisense; GGCAAATGTTCTTTCGCATTGCTTC
>probe:Drosophila_2:1627377_at:709:343; Interrogation_Position=1706; Antisense; GCATTGCTTCCTGCTTAACGAATCA
>probe:Drosophila_2:1627377_at:550:247; Interrogation_Position=1737; Antisense; CAATTGAATGTCACCGGGAGCCAAA
>probe:Drosophila_2:1627377_at:499:389; Interrogation_Position=1765; Antisense; GAAATCCCATTTATGGAACCCTTCT
>probe:Drosophila_2:1627377_at:698:379; Interrogation_Position=1780; Antisense; GAACCCTTCTTAAACTCTTTGGCAT
>probe:Drosophila_2:1627377_at:180:423; Interrogation_Position=1809; Antisense; GAGAAGTTTGCGCATATGACCCAAA
>probe:Drosophila_2:1627377_at:254:391; Interrogation_Position=1835; Antisense; GAAAGATCCGTCTGATGACTTAGAG
>probe:Drosophila_2:1627377_at:337:721; Interrogation_Position=1900; Antisense; TTGCGAGCCTTATCCAACTATTAGT
>probe:Drosophila_2:1627377_at:11:165; Interrogation_Position=1932; Antisense; AAATCAGCTTCTTGTTTGGGTCCGC
>probe:Drosophila_2:1627377_at:626:119; Interrogation_Position=1963; Antisense; AGCTGCTTTTGCGTTTGGATTTCAA
>probe:Drosophila_2:1627377_at:302:653; Interrogation_Position=1984; Antisense; TCAATTGTTGGTTCAGTGCCAGTCA
>probe:Drosophila_2:1627377_at:707:505; Interrogation_Position=1999; Antisense; GTGCCAGTCATAATACGTCCGCATG
>probe:Drosophila_2:1627377_at:527:697; Interrogation_Position=2034; Antisense; TTTTGCCTAAAGTTGTAGCCGCTTA

Paste this into a BLAST search page for me
GGCTCACACTGTATTTCTGGCAAATGGCAAATGTTCTTTCGCATTGCTTCGCATTGCTTCCTGCTTAACGAATCACAATTGAATGTCACCGGGAGCCAAAGAAATCCCATTTATGGAACCCTTCTGAACCCTTCTTAAACTCTTTGGCATGAGAAGTTTGCGCATATGACCCAAAGAAAGATCCGTCTGATGACTTAGAGTTGCGAGCCTTATCCAACTATTAGTAAATCAGCTTCTTGTTTGGGTCCGCAGCTGCTTTTGCGTTTGGATTTCAATCAATTGTTGGTTCAGTGCCAGTCAGTGCCAGTCATAATACGTCCGCATGTTTTGCCTAAAGTTGTAGCCGCTTA

Full Affymetrix probeset data:

Annotations for 1627377_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime