Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627379_at:

>probe:Drosophila_2:1627379_at:291:421; Interrogation_Position=1472; Antisense; GAGCACTGAGTGAATTCCTGAACCA
>probe:Drosophila_2:1627379_at:96:703; Interrogation_Position=1508; Antisense; TTTTGGCCTGGCTGAGAGCATCCGG
>probe:Drosophila_2:1627379_at:489:47; Interrogation_Position=1527; Antisense; ATCCGGCCAACATCAATTGCAGCAA
>probe:Drosophila_2:1627379_at:465:395; Interrogation_Position=1568; Antisense; GAAATCTCCAGCAGGCCAAGCAGTT
>probe:Drosophila_2:1627379_at:430:227; Interrogation_Position=1634; Antisense; AAGGCGAACTGATCAACCTGCTGCT
>probe:Drosophila_2:1627379_at:549:621; Interrogation_Position=1652; Antisense; TGCTGCTCGAATCCATCAAGGTCCA
>probe:Drosophila_2:1627379_at:393:223; Interrogation_Position=1669; Antisense; AAGGTCCATCTGGAGTCCCTGAGTC
>probe:Drosophila_2:1627379_at:272:607; Interrogation_Position=1688; Antisense; TGAGTCCCCAAGAGCGCTACGATGT
>probe:Drosophila_2:1627379_at:108:443; Interrogation_Position=1708; Antisense; GATGTGGACTCCAAGGCGGAATCCT
>probe:Drosophila_2:1627379_at:370:655; Interrogation_Position=1755; Antisense; TAAGGACCTGGTTCTGAAGCGTGTG
>probe:Drosophila_2:1627379_at:249:207; Interrogation_Position=1771; Antisense; AAGCGTGTGGATTATGTGTCCCTGC
>probe:Drosophila_2:1627379_at:277:515; Interrogation_Position=1786; Antisense; GTGTCCCTGCTGATAGACTTCTTTG
>probe:Drosophila_2:1627379_at:327:105; Interrogation_Position=1800; Antisense; AGACTTCTTTGAGCTGGCCAACGAG
>probe:Drosophila_2:1627379_at:514:331; Interrogation_Position=1946; Antisense; GCGGACAGCGATTCATCAACCTAAA

Paste this into a BLAST search page for me
GAGCACTGAGTGAATTCCTGAACCATTTTGGCCTGGCTGAGAGCATCCGGATCCGGCCAACATCAATTGCAGCAAGAAATCTCCAGCAGGCCAAGCAGTTAAGGCGAACTGATCAACCTGCTGCTTGCTGCTCGAATCCATCAAGGTCCAAAGGTCCATCTGGAGTCCCTGAGTCTGAGTCCCCAAGAGCGCTACGATGTGATGTGGACTCCAAGGCGGAATCCTTAAGGACCTGGTTCTGAAGCGTGTGAAGCGTGTGGATTATGTGTCCCTGCGTGTCCCTGCTGATAGACTTCTTTGAGACTTCTTTGAGCTGGCCAACGAGGCGGACAGCGATTCATCAACCTAAA

Full Affymetrix probeset data:

Annotations for 1627379_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime