Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627380_at:

>probe:Drosophila_2:1627380_at:680:657; Interrogation_Position=1549; Antisense; TAACGCACTGTTTCCCAACTTTAAG
>probe:Drosophila_2:1627380_at:619:217; Interrogation_Position=1571; Antisense; AAGTACCGACTGCTGATCAACATGA
>probe:Drosophila_2:1627380_at:549:305; Interrogation_Position=1613; Antisense; TCCAACCGTTGGGTCAGCAGTTTTA
>probe:Drosophila_2:1627380_at:419:61; Interrogation_Position=1641; Antisense; AGGTCGGTGAACAGCTTCTCGGGCA
>probe:Drosophila_2:1627380_at:654:713; Interrogation_Position=1656; Antisense; TTCTCGGGCACACTTCGCAGGAAGT
>probe:Drosophila_2:1627380_at:283:533; Interrogation_Position=1682; Antisense; GGTGAGGCCCTTGAGAACGACCCTG
>probe:Drosophila_2:1627380_at:241:115; Interrogation_Position=1716; Antisense; AGCAGATTTTCTCAGCACTCAACTT
>probe:Drosophila_2:1627380_at:547:149; Interrogation_Position=1742; Antisense; ACTTCACACATCTTTAAGCTGCGCT
>probe:Drosophila_2:1627380_at:281:153; Interrogation_Position=1788; Antisense; ACATGACTCGCAACAAGCTCACTGT
>probe:Drosophila_2:1627380_at:179:597; Interrogation_Position=1810; Antisense; TGTGCAGTCTGTAGCCCCTATCAAT
>probe:Drosophila_2:1627380_at:166:199; Interrogation_Position=1879; Antisense; AACCGGCATTGGCTCATCAAACTGA
>probe:Drosophila_2:1627380_at:222:501; Interrogation_Position=1916; Antisense; GTGCGCCAAAACACGTTTCCCATAA
>probe:Drosophila_2:1627380_at:513:61; Interrogation_Position=2001; Antisense; ATGGGTTGTTATTCAGCTACGCTTC
>probe:Drosophila_2:1627380_at:454:649; Interrogation_Position=2013; Antisense; TCAGCTACGCTTCCCTTAATTAAAA

Paste this into a BLAST search page for me
TAACGCACTGTTTCCCAACTTTAAGAAGTACCGACTGCTGATCAACATGATCCAACCGTTGGGTCAGCAGTTTTAAGGTCGGTGAACAGCTTCTCGGGCATTCTCGGGCACACTTCGCAGGAAGTGGTGAGGCCCTTGAGAACGACCCTGAGCAGATTTTCTCAGCACTCAACTTACTTCACACATCTTTAAGCTGCGCTACATGACTCGCAACAAGCTCACTGTTGTGCAGTCTGTAGCCCCTATCAATAACCGGCATTGGCTCATCAAACTGAGTGCGCCAAAACACGTTTCCCATAAATGGGTTGTTATTCAGCTACGCTTCTCAGCTACGCTTCCCTTAATTAAAA

Full Affymetrix probeset data:

Annotations for 1627380_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime