FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627382_at:

>probe:Drosophila_2:1627382_at:598:347; Interrogation_Position=358; Antisense; GCATGTGGCGTTTCTACACGGACGA
>probe:Drosophila_2:1627382_at:56:395; Interrogation_Position=381; Antisense; GACTCGCCCGGTATCAAAGTTGGTC
>probe:Drosophila_2:1627382_at:579:719; Interrogation_Position=443; Antisense; TTCCGTCTTCATGCTGCACATTTGG
>probe:Drosophila_2:1627382_at:323:241; Interrogation_Position=472; Antisense; AATACAATCGTTCTTAAGCCATGCA
>probe:Drosophila_2:1627382_at:30:203; Interrogation_Position=487; Antisense; AAGCCATGCATTTCGTAGCCAATAA
>probe:Drosophila_2:1627382_at:350:185; Interrogation_Position=510; Antisense; AAAATACTTTCACCTCAACGAGCGT
>probe:Drosophila_2:1627382_at:450:327; Interrogation_Position=531; Antisense; GCGTGAACAATGTCGACGTCATCAT
>probe:Drosophila_2:1627382_at:501:139; Interrogation_Position=546; Antisense; ACGTCATCATTTCTTTTGCGGCGAG
>probe:Drosophila_2:1627382_at:567:97; Interrogation_Position=579; Antisense; AGATCCATTCCGCTTGTTGAGGCAT
>probe:Drosophila_2:1627382_at:233:727; Interrogation_Position=595; Antisense; TTGAGGCATTGGTGTGTTTCCACAT
>probe:Drosophila_2:1627382_at:559:45; Interrogation_Position=712; Antisense; ATCCGGCGGGCTGAGAATTCATTCC
>probe:Drosophila_2:1627382_at:275:245; Interrogation_Position=739; Antisense; AATTTATCGTGGTCATGTGCATCAG
>probe:Drosophila_2:1627382_at:539:597; Interrogation_Position=754; Antisense; TGTGCATCAGAAATTCCGCGCGCAG
>probe:Drosophila_2:1627382_at:263:323; Interrogation_Position=771; Antisense; GCGCGCAGCCGTTGCAATTCAAGAA

Paste this into a BLAST search page for me
GCATGTGGCGTTTCTACACGGACGAGACTCGCCCGGTATCAAAGTTGGTCTTCCGTCTTCATGCTGCACATTTGGAATACAATCGTTCTTAAGCCATGCAAAGCCATGCATTTCGTAGCCAATAAAAAATACTTTCACCTCAACGAGCGTGCGTGAACAATGTCGACGTCATCATACGTCATCATTTCTTTTGCGGCGAGAGATCCATTCCGCTTGTTGAGGCATTTGAGGCATTGGTGTGTTTCCACATATCCGGCGGGCTGAGAATTCATTCCAATTTATCGTGGTCATGTGCATCAGTGTGCATCAGAAATTCCGCGCGCAGGCGCGCAGCCGTTGCAATTCAAGAA

Full Affymetrix probeset data:

Annotations for 1627382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720