Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627383_at:

>probe:Drosophila_2:1627383_at:688:537; Interrogation_Position=5709; Antisense; GGTATTCGCCCACTGTCCTAAAAAG
>probe:Drosophila_2:1627383_at:38:23; Interrogation_Position=5753; Antisense; ATATGACCAACCCAGAGGCCATTTA
>probe:Drosophila_2:1627383_at:66:315; Interrogation_Position=5770; Antisense; GCCATTTACATGGTGCGCGAAACTA
>probe:Drosophila_2:1627383_at:649:177; Interrogation_Position=5789; Antisense; AAACTAAGAAGCTCGTGGCCCGCAA
>probe:Drosophila_2:1627383_at:294:377; Interrogation_Position=5823; Antisense; GAAGCAAAATGCACGCAAGCCGCCG
>probe:Drosophila_2:1627383_at:311:205; Interrogation_Position=5839; Antisense; AAGCCGCCGCCAATGACAAGTGGAC
>probe:Drosophila_2:1627383_at:288:93; Interrogation_Position=5879; Antisense; AGATAAACTTCACGCCGTGTTCCCT
>probe:Drosophila_2:1627383_at:472:125; Interrogation_Position=5908; Antisense; AGCCTGGAGCCGGACTTCGGAATCA
>probe:Drosophila_2:1627383_at:444:557; Interrogation_Position=5919; Antisense; GGACTTCGGAATCATCCGCTACAGT
>probe:Drosophila_2:1627383_at:301:397; Interrogation_Position=5947; Antisense; TACACGTTTATCTCGTCCGTTTACG
>probe:Drosophila_2:1627383_at:115:499; Interrogation_Position=5961; Antisense; GTCCGTTTACGCCTTCGATACGATT
>probe:Drosophila_2:1627383_at:429:293; Interrogation_Position=5976; Antisense; CGATACGATTTTGTGCAAGCTGCAG
>probe:Drosophila_2:1627383_at:507:207; Interrogation_Position=5992; Antisense; AAGCTGCAGATCGACATGTTTTAGA
>probe:Drosophila_2:1627383_at:627:413; Interrogation_Position=6095; Antisense; GACCATGCTAGTTTTTTGGAGACAA

Paste this into a BLAST search page for me
GGTATTCGCCCACTGTCCTAAAAAGATATGACCAACCCAGAGGCCATTTAGCCATTTACATGGTGCGCGAAACTAAAACTAAGAAGCTCGTGGCCCGCAAGAAGCAAAATGCACGCAAGCCGCCGAAGCCGCCGCCAATGACAAGTGGACAGATAAACTTCACGCCGTGTTCCCTAGCCTGGAGCCGGACTTCGGAATCAGGACTTCGGAATCATCCGCTACAGTTACACGTTTATCTCGTCCGTTTACGGTCCGTTTACGCCTTCGATACGATTCGATACGATTTTGTGCAAGCTGCAGAAGCTGCAGATCGACATGTTTTAGAGACCATGCTAGTTTTTTGGAGACAA

Full Affymetrix probeset data:

Annotations for 1627383_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime