FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627384_at:

>probe:Drosophila_2:1627384_at:383:161; Interrogation_Position=2145; Antisense; ACAATGCCAAGATCCGGAACGATAT
>probe:Drosophila_2:1627384_at:192:207; Interrogation_Position=2183; Antisense; AAGCGACTGGGCAACATGCGGGCCT
>probe:Drosophila_2:1627384_at:667:51; Interrogation_Position=2198; Antisense; ATGCGGGCCTTCTACTGGATGATGA
>probe:Drosophila_2:1627384_at:163:379; Interrogation_Position=2221; Antisense; GAACCAAACGCGTCACATTCGGGAG
>probe:Drosophila_2:1627384_at:362:273; Interrogation_Position=2236; Antisense; CATTCGGGAGTATCTGCCTGAGGAT
>probe:Drosophila_2:1627384_at:632:607; Interrogation_Position=2254; Antisense; TGAGGATGAGTACCGCTCTGCGACC
>probe:Drosophila_2:1627384_at:449:419; Interrogation_Position=2280; Antisense; GAGCAGGAAGCTGTGGTCACTCCGC
>probe:Drosophila_2:1627384_at:438:403; Interrogation_Position=2331; Antisense; GACTAATGGTTATCCTTTCTGCGAT
>probe:Drosophila_2:1627384_at:91:293; Interrogation_Position=2352; Antisense; CGATTATACCCTCGCGATCCTAAGG
>probe:Drosophila_2:1627384_at:589:75; Interrogation_Position=2374; Antisense; AGGACCAGAGCTTTCAGTGTACACT
>probe:Drosophila_2:1627384_at:271:677; Interrogation_Position=2499; Antisense; TAGTAACGTCATTTGGCCCTAAGCA
>probe:Drosophila_2:1627384_at:212:567; Interrogation_Position=2513; Antisense; GGCCCTAAGCATCCAGTTTTGATCG
>probe:Drosophila_2:1627384_at:190:451; Interrogation_Position=2533; Antisense; GATCGAATAAAGTCGCACCCTGCCA
>probe:Drosophila_2:1627384_at:142:29; Interrogation_Position=2670; Antisense; ATACGAGCATTGTCTTTATACTTAA

Paste this into a BLAST search page for me
ACAATGCCAAGATCCGGAACGATATAAGCGACTGGGCAACATGCGGGCCTATGCGGGCCTTCTACTGGATGATGAGAACCAAACGCGTCACATTCGGGAGCATTCGGGAGTATCTGCCTGAGGATTGAGGATGAGTACCGCTCTGCGACCGAGCAGGAAGCTGTGGTCACTCCGCGACTAATGGTTATCCTTTCTGCGATCGATTATACCCTCGCGATCCTAAGGAGGACCAGAGCTTTCAGTGTACACTTAGTAACGTCATTTGGCCCTAAGCAGGCCCTAAGCATCCAGTTTTGATCGGATCGAATAAAGTCGCACCCTGCCAATACGAGCATTGTCTTTATACTTAA

Full Affymetrix probeset data:

Annotations for 1627384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720