Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627385_at:

>probe:Drosophila_2:1627385_at:287:393; Interrogation_Position=154; Antisense; GAAAGCTGCGAATGCGATGCTTAAA
>probe:Drosophila_2:1627385_at:384:553; Interrogation_Position=186; Antisense; GGAGCTTCTGTAGATGTGATTGACA
>probe:Drosophila_2:1627385_at:303:363; Interrogation_Position=226; Antisense; GAATACTACCTACAGATCCCGAGAT
>probe:Drosophila_2:1627385_at:595:449; Interrogation_Position=240; Antisense; GATCCCGAGATCAAGTGTTTTCTCT
>probe:Drosophila_2:1627385_at:133:515; Interrogation_Position=254; Antisense; GTGTTTTCTCTACTGCATGTTTGAT
>probe:Drosophila_2:1627385_at:280:457; Interrogation_Position=276; Antisense; GATATGTTCGGATTGATTGATTCAC
>probe:Drosophila_2:1627385_at:303:377; Interrogation_Position=318; Antisense; GAAGCACTGTTGGAGGTTTTACCCG
>probe:Drosophila_2:1627385_at:164:141; Interrogation_Position=364; Antisense; ACGGATTAGTCAGTTCATGTGGAAC
>probe:Drosophila_2:1627385_at:43:101; Interrogation_Position=401; Antisense; AGATGGCTGTGATACCGCTTATGAA
>probe:Drosophila_2:1627385_at:610:455; Interrogation_Position=411; Antisense; GATACCGCTTATGAAACCGTCAAGT
>probe:Drosophila_2:1627385_at:71:201; Interrogation_Position=425; Antisense; AACCGTCAAGTGCTACATTGCTGTA
>probe:Drosophila_2:1627385_at:237:593; Interrogation_Position=488; Antisense; TGGGTAGCGCTAACCAACCTAAATA
>probe:Drosophila_2:1627385_at:646:663; Interrogation_Position=507; Antisense; TAAATATATCCCGATCCACGATTCC
>probe:Drosophila_2:1627385_at:85:49; Interrogation_Position=520; Antisense; ATCCACGATTCCCAAGAGCAGCAAA

Paste this into a BLAST search page for me
GAAAGCTGCGAATGCGATGCTTAAAGGAGCTTCTGTAGATGTGATTGACAGAATACTACCTACAGATCCCGAGATGATCCCGAGATCAAGTGTTTTCTCTGTGTTTTCTCTACTGCATGTTTGATGATATGTTCGGATTGATTGATTCACGAAGCACTGTTGGAGGTTTTACCCGACGGATTAGTCAGTTCATGTGGAACAGATGGCTGTGATACCGCTTATGAAGATACCGCTTATGAAACCGTCAAGTAACCGTCAAGTGCTACATTGCTGTATGGGTAGCGCTAACCAACCTAAATATAAATATATCCCGATCCACGATTCCATCCACGATTCCCAAGAGCAGCAAA

Full Affymetrix probeset data:

Annotations for 1627385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime