FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627386_at:

>probe:Drosophila_2:1627386_at:542:377; Interrogation_Position=27; Antisense; GAACTATCTTCAGAAAAACGGAGGA
>probe:Drosophila_2:1627386_at:490:221; Interrogation_Position=461; Antisense; AAGGAGTGGATTCCAATGAGGACTC
>probe:Drosophila_2:1627386_at:1:439; Interrogation_Position=47; Antisense; GAGGAAAACTAACTTGTCGCCTTTG
>probe:Drosophila_2:1627386_at:548:607; Interrogation_Position=477; Antisense; TGAGGACTCCATAAGCAGCGAAGGT
>probe:Drosophila_2:1627386_at:715:629; Interrogation_Position=484; Antisense; TCCATAAGCAGCGAAGGTGAGGGCA
>probe:Drosophila_2:1627386_at:534:607; Interrogation_Position=501; Antisense; TGAGGGCAGCCTTGGTGATAATTTC
>probe:Drosophila_2:1627386_at:628:565; Interrogation_Position=505; Antisense; GGCAGCCTTGGTGATAATTTCTCAA
>probe:Drosophila_2:1627386_at:334:455; Interrogation_Position=517; Antisense; GATAATTTCTCAACATCCAAGCAAT
>probe:Drosophila_2:1627386_at:483:189; Interrogation_Position=528; Antisense; AACATCCAAGCAATCGAAGGCAAAC
>probe:Drosophila_2:1627386_at:473:661; Interrogation_Position=56; Antisense; TAACTTGTCGCCTTTGTAATCATCA
>probe:Drosophila_2:1627386_at:605:423; Interrogation_Position=560; Antisense; GAGACATTGACAGGAAACGAATTTG
>probe:Drosophila_2:1627386_at:102:365; Interrogation_Position=578; Antisense; GAATTTGTAACCGACCAGTAAATGT
>probe:Drosophila_2:1627386_at:200:661; Interrogation_Position=596; Antisense; TAAATGTGGGAGAGTGTCAGCAGAA
>probe:Drosophila_2:1627386_at:376:493; Interrogation_Position=71; Antisense; GTAATCATCAATTGGGCTCGTACTT

Paste this into a BLAST search page for me
GAACTATCTTCAGAAAAACGGAGGAAAGGAGTGGATTCCAATGAGGACTCGAGGAAAACTAACTTGTCGCCTTTGTGAGGACTCCATAAGCAGCGAAGGTTCCATAAGCAGCGAAGGTGAGGGCATGAGGGCAGCCTTGGTGATAATTTCGGCAGCCTTGGTGATAATTTCTCAAGATAATTTCTCAACATCCAAGCAATAACATCCAAGCAATCGAAGGCAAACTAACTTGTCGCCTTTGTAATCATCAGAGACATTGACAGGAAACGAATTTGGAATTTGTAACCGACCAGTAAATGTTAAATGTGGGAGAGTGTCAGCAGAAGTAATCATCAATTGGGCTCGTACTT

Full Affymetrix probeset data:

Annotations for 1627386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720