FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627388_at:

>probe:Drosophila_2:1627388_at:635:125; Interrogation_Position=13; Antisense; ACCATTCGACTTGAACTGTTCGATA
>probe:Drosophila_2:1627388_at:268:303; Interrogation_Position=377; Antisense; CCGTGGCATAAGTGAAGTTGCTTTC
>probe:Drosophila_2:1627388_at:228:375; Interrogation_Position=390; Antisense; GAAGTTGCTTTCACTGTAAGCAGCT
>probe:Drosophila_2:1627388_at:359:493; Interrogation_Position=405; Antisense; GTAAGCAGCTTTAAACCCACCAATT
>probe:Drosophila_2:1627388_at:728:101; Interrogation_Position=411; Antisense; AGCTTTAAACCCACCAATTCTGCAA
>probe:Drosophila_2:1627388_at:658:697; Interrogation_Position=414; Antisense; TTTAAACCCACCAATTCTGCAACAC
>probe:Drosophila_2:1627388_at:602:261; Interrogation_Position=422; Antisense; CACCAATTCTGCAACACTCTTTGTT
>probe:Drosophila_2:1627388_at:118:643; Interrogation_Position=429; Antisense; TCTGCAACACTCTTTGTTATCTTCC
>probe:Drosophila_2:1627388_at:224:255; Interrogation_Position=433; Antisense; CAACACTCTTTGTTATCTTCCCCAA
>probe:Drosophila_2:1627388_at:22:645; Interrogation_Position=439; Antisense; TCTTTGTTATCTTCCCCAACACTTA
>probe:Drosophila_2:1627388_at:128:603; Interrogation_Position=443; Antisense; TGTTATCTTCCCCAACACTTACCTA
>probe:Drosophila_2:1627388_at:412:391; Interrogation_Position=492; Antisense; GAAAGAATCCTAAGTTACAGAACGC
>probe:Drosophila_2:1627388_at:469:601; Interrogation_Position=499; Antisense; TCCTAAGTTACAGAACGCAGTTTGT
>probe:Drosophila_2:1627388_at:454:155; Interrogation_Position=508; Antisense; ACAGAACGCAGTTTGTTGAATATTA

Paste this into a BLAST search page for me
ACCATTCGACTTGAACTGTTCGATACCGTGGCATAAGTGAAGTTGCTTTCGAAGTTGCTTTCACTGTAAGCAGCTGTAAGCAGCTTTAAACCCACCAATTAGCTTTAAACCCACCAATTCTGCAATTTAAACCCACCAATTCTGCAACACCACCAATTCTGCAACACTCTTTGTTTCTGCAACACTCTTTGTTATCTTCCCAACACTCTTTGTTATCTTCCCCAATCTTTGTTATCTTCCCCAACACTTATGTTATCTTCCCCAACACTTACCTAGAAAGAATCCTAAGTTACAGAACGCTCCTAAGTTACAGAACGCAGTTTGTACAGAACGCAGTTTGTTGAATATTA

Full Affymetrix probeset data:

Annotations for 1627388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720