FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627390_at:

>probe:Drosophila_2:1627390_at:456:165; Interrogation_Position=6863; Antisense; AAATCGAGAGTCCTTACTCGCCGGG
>probe:Drosophila_2:1627390_at:50:573; Interrogation_Position=6886; Antisense; GGCTCGGCGGACTACGAAGATCTGT
>probe:Drosophila_2:1627390_at:348:375; Interrogation_Position=6901; Antisense; GAAGATCTGTTCGAGCCACCCATTC
>probe:Drosophila_2:1627390_at:605:201; Interrogation_Position=6988; Antisense; AACCTGTTCGGAAGCAGTTCGCCCA
>probe:Drosophila_2:1627390_at:600:93; Interrogation_Position=7003; Antisense; AGTTCGCCCATTAGTAACATCCGGA
>probe:Drosophila_2:1627390_at:528:443; Interrogation_Position=7026; Antisense; GATGACTTCCCGGTACAACACAGCG
>probe:Drosophila_2:1627390_at:111:701; Interrogation_Position=7120; Antisense; TTTTATGACGACGTGCCGAACTCGG
>probe:Drosophila_2:1627390_at:57:383; Interrogation_Position=7137; Antisense; GAACTCGGCGACAGATCTACAAAAT
>probe:Drosophila_2:1627390_at:244:389; Interrogation_Position=7215; Antisense; GAAACTGGTGTTGAAGCCCTACTTT
>probe:Drosophila_2:1627390_at:543:551; Interrogation_Position=7283; Antisense; GGAGAGCCGTTCCAAAGATCTGCCA
>probe:Drosophila_2:1627390_at:529:97; Interrogation_Position=7298; Antisense; AGATCTGCCACAGTCGGTCAGGTGA
>probe:Drosophila_2:1627390_at:625:537; Interrogation_Position=7313; Antisense; GGTCAGGTGAGATCAATCCGCACAA
>probe:Drosophila_2:1627390_at:684:209; Interrogation_Position=7342; Antisense; AAGAATCTTATTGACGCCTACGTGA
>probe:Drosophila_2:1627390_at:284:327; Interrogation_Position=7426; Antisense; GCGGTTAAGTGTGCCGCCTATTTAA

Paste this into a BLAST search page for me
AAATCGAGAGTCCTTACTCGCCGGGGGCTCGGCGGACTACGAAGATCTGTGAAGATCTGTTCGAGCCACCCATTCAACCTGTTCGGAAGCAGTTCGCCCAAGTTCGCCCATTAGTAACATCCGGAGATGACTTCCCGGTACAACACAGCGTTTTATGACGACGTGCCGAACTCGGGAACTCGGCGACAGATCTACAAAATGAAACTGGTGTTGAAGCCCTACTTTGGAGAGCCGTTCCAAAGATCTGCCAAGATCTGCCACAGTCGGTCAGGTGAGGTCAGGTGAGATCAATCCGCACAAAAGAATCTTATTGACGCCTACGTGAGCGGTTAAGTGTGCCGCCTATTTAA

Full Affymetrix probeset data:

Annotations for 1627390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720