FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627393_at:

>probe:Drosophila_2:1627393_at:520:245; Interrogation_Position=17; Antisense; AATTCTTGACCGTATTTGCATTCGC
>probe:Drosophila_2:1627393_at:416:43; Interrogation_Position=191; Antisense; ATCCAGGGACCGGAACCAACGCAGA
>probe:Drosophila_2:1627393_at:676:199; Interrogation_Position=208; Antisense; AACGCAGAACCAGGTCCGAGGAGCA
>probe:Drosophila_2:1627393_at:676:623; Interrogation_Position=222; Antisense; TCCGAGGAGCAAACCGAATCCCAGT
>probe:Drosophila_2:1627393_at:36:641; Interrogation_Position=250; Antisense; TCGGCACCAGCAACTCTTTTGGAAG
>probe:Drosophila_2:1627393_at:290:109; Interrogation_Position=281; Antisense; AGCAAGACAACTTTGCGGTTCCGCT
>probe:Drosophila_2:1627393_at:368:391; Interrogation_Position=310; Antisense; GAAACTGCTCCGCAAAAGCTGGATG
>probe:Drosophila_2:1627393_at:397:205; Interrogation_Position=325; Antisense; AAGCTGGATGATGTTCAGGCCGATC
>probe:Drosophila_2:1627393_at:302:619; Interrogation_Position=33; Antisense; TGCATTCGCCTGTGTGGCAACATTT
>probe:Drosophila_2:1627393_at:475:261; Interrogation_Position=352; Antisense; CAGCCGGCTTAGTGGGTGCATGACC
>probe:Drosophila_2:1627393_at:491:113; Interrogation_Position=397; Antisense; AGCAGCTTAATCCAACTGGAGCCTG
>probe:Drosophila_2:1627393_at:154:159; Interrogation_Position=431; Antisense; ACACAAGGGAGACACGCACACATAT
>probe:Drosophila_2:1627393_at:222:567; Interrogation_Position=48; Antisense; GGCAACATTTGTGGTGCTCCACGGC
>probe:Drosophila_2:1627393_at:377:481; Interrogation_Position=492; Antisense; GTATTCCAACTTCTAGCATGGGCAT

Paste this into a BLAST search page for me
AATTCTTGACCGTATTTGCATTCGCATCCAGGGACCGGAACCAACGCAGAAACGCAGAACCAGGTCCGAGGAGCATCCGAGGAGCAAACCGAATCCCAGTTCGGCACCAGCAACTCTTTTGGAAGAGCAAGACAACTTTGCGGTTCCGCTGAAACTGCTCCGCAAAAGCTGGATGAAGCTGGATGATGTTCAGGCCGATCTGCATTCGCCTGTGTGGCAACATTTCAGCCGGCTTAGTGGGTGCATGACCAGCAGCTTAATCCAACTGGAGCCTGACACAAGGGAGACACGCACACATATGGCAACATTTGTGGTGCTCCACGGCGTATTCCAACTTCTAGCATGGGCAT

Full Affymetrix probeset data:

Annotations for 1627393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720