FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627397_at:

>probe:Drosophila_2:1627397_at:568:15; Interrogation_Position=1000; Antisense; ATTATGGCACACTGTCATGCTGGGC
>probe:Drosophila_2:1627397_at:701:49; Interrogation_Position=1090; Antisense; ATGCCGTCAGCAATTGTACCGTCTT
>probe:Drosophila_2:1627397_at:666:609; Interrogation_Position=1136; Antisense; TGACATACAGTGCATACCGGGCTAT
>probe:Drosophila_2:1627397_at:223:333; Interrogation_Position=1165; Antisense; GCGGCCTGCCGCAAATATTTGTACT
>probe:Drosophila_2:1627397_at:157:395; Interrogation_Position=1191; Antisense; GAAATGTTTTCAACACGCACCGGCA
>probe:Drosophila_2:1627397_at:390:171; Interrogation_Position=1247; Antisense; AAAGATATCTGGTCTTGACACCCCA
>probe:Drosophila_2:1627397_at:416:455; Interrogation_Position=715; Antisense; GATACGGTATCTGGCTTGTCACTCA
>probe:Drosophila_2:1627397_at:158:571; Interrogation_Position=727; Antisense; GGCTTGTCACTCAACAGGTGCCAGA
>probe:Drosophila_2:1627397_at:698:327; Interrogation_Position=811; Antisense; GCGTAATATTAATTGGCGCCTCTAA
>probe:Drosophila_2:1627397_at:60:323; Interrogation_Position=826; Antisense; GCGCCTCTAAGGACGAGACTGTTGA
>probe:Drosophila_2:1627397_at:423:319; Interrogation_Position=881; Antisense; GCCGCGGACTTTTCGCTGGAAATTC
>probe:Drosophila_2:1627397_at:192:157; Interrogation_Position=909; Antisense; AACTCGGGCGAAACTCTGGACGTGG
>probe:Drosophila_2:1627397_at:209:199; Interrogation_Position=940; Antisense; AACGATTCAGCGTGAACGGCAGCCG
>probe:Drosophila_2:1627397_at:427:141; Interrogation_Position=955; Antisense; ACGGCAGCCGCAGCATTTTAAAGTA

Paste this into a BLAST search page for me
ATTATGGCACACTGTCATGCTGGGCATGCCGTCAGCAATTGTACCGTCTTTGACATACAGTGCATACCGGGCTATGCGGCCTGCCGCAAATATTTGTACTGAAATGTTTTCAACACGCACCGGCAAAAGATATCTGGTCTTGACACCCCAGATACGGTATCTGGCTTGTCACTCAGGCTTGTCACTCAACAGGTGCCAGAGCGTAATATTAATTGGCGCCTCTAAGCGCCTCTAAGGACGAGACTGTTGAGCCGCGGACTTTTCGCTGGAAATTCAACTCGGGCGAAACTCTGGACGTGGAACGATTCAGCGTGAACGGCAGCCGACGGCAGCCGCAGCATTTTAAAGTA

Full Affymetrix probeset data:

Annotations for 1627397_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720