Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627399_at:

>probe:Drosophila_2:1627399_at:550:607; Interrogation_Position=106; Antisense; TGAGAAGCTCCAACAATCCCGTCGT
>probe:Drosophila_2:1627399_at:12:477; Interrogation_Position=129; Antisense; GTTTTCTTCGACATTGCCGTAGGCA
>probe:Drosophila_2:1627399_at:425:389; Interrogation_Position=213; Antisense; GAAAACTTCCGGCAGTTCTGCACGG
>probe:Drosophila_2:1627399_at:25:69; Interrogation_Position=253; Antisense; ATGGCGTTCCCATTGGCTACAAAGG
>probe:Drosophila_2:1627399_at:630:167; Interrogation_Position=273; Antisense; AAAGGCGCCAGTTTCCATCGGGTGA
>probe:Drosophila_2:1627399_at:31:611; Interrogation_Position=352; Antisense; TGACCAGCATATACGGCAACACCTT
>probe:Drosophila_2:1627399_at:304:711; Interrogation_Position=375; Antisense; TTCGGCGACGAGAACTTTACCCTGA
>probe:Drosophila_2:1627399_at:146:317; Interrogation_Position=415; Antisense; GCCTCCTTTCCATGGCAAACAGTGG
>probe:Drosophila_2:1627399_at:657:421; Interrogation_Position=444; Antisense; GAGACGAACGGCTGCCAATTCTTTA
>probe:Drosophila_2:1627399_at:78:247; Interrogation_Position=460; Antisense; AATTCTTTATCACCTGCGCCAAGTG
>probe:Drosophila_2:1627399_at:569:529; Interrogation_Position=520; Antisense; GGGTTCTGGATGGACTGCTCATCAT
>probe:Drosophila_2:1627399_at:272:145; Interrogation_Position=533; Antisense; ACTGCTCATCATGCGCAAGATCGAG
>probe:Drosophila_2:1627399_at:497:239; Interrogation_Position=576; Antisense; AATAACAAGCCGAAGCTCCCAGTGA
>probe:Drosophila_2:1627399_at:220:511; Interrogation_Position=597; Antisense; GTGACCATTTCGCAGTGCGGGCAAA

Paste this into a BLAST search page for me
TGAGAAGCTCCAACAATCCCGTCGTGTTTTCTTCGACATTGCCGTAGGCAGAAAACTTCCGGCAGTTCTGCACGGATGGCGTTCCCATTGGCTACAAAGGAAAGGCGCCAGTTTCCATCGGGTGATGACCAGCATATACGGCAACACCTTTTCGGCGACGAGAACTTTACCCTGAGCCTCCTTTCCATGGCAAACAGTGGGAGACGAACGGCTGCCAATTCTTTAAATTCTTTATCACCTGCGCCAAGTGGGGTTCTGGATGGACTGCTCATCATACTGCTCATCATGCGCAAGATCGAGAATAACAAGCCGAAGCTCCCAGTGAGTGACCATTTCGCAGTGCGGGCAAA

Full Affymetrix probeset data:

Annotations for 1627399_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime