FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627401_at:

>probe:Drosophila_2:1627401_at:44:517; Interrogation_Position=1031; Antisense; GTGGGCCAACCGATTGAACCGTGAG
>probe:Drosophila_2:1627401_at:86:571; Interrogation_Position=566; Antisense; GGCTACCAGCTAACCGGAGTTTGAA
>probe:Drosophila_2:1627401_at:176:447; Interrogation_Position=607; Antisense; GATGCGATGGAAGAACCGCCCTTGC
>probe:Drosophila_2:1627401_at:182:483; Interrogation_Position=692; Antisense; GTATACAGACATTCGATTTGGCAGC
>probe:Drosophila_2:1627401_at:305:21; Interrogation_Position=707; Antisense; ATTTGGCAGCTGTTTTACGCCTACA
>probe:Drosophila_2:1627401_at:481:667; Interrogation_Position=728; Antisense; TACATGGCGCCGAAGCAGTGGACAA
>probe:Drosophila_2:1627401_at:204:217; Interrogation_Position=752; Antisense; AAGTTCTAAGTTGCCCATCGAGACG
>probe:Drosophila_2:1627401_at:260:669; Interrogation_Position=836; Antisense; TACTGGAGCATTTGCATTCGGCGCA
>probe:Drosophila_2:1627401_at:248:245; Interrogation_Position=860; Antisense; AATTCTACGAATCCTTGTCCTCTTT
>probe:Drosophila_2:1627401_at:320:485; Interrogation_Position=889; Antisense; GTAGGACTTCATTCTGGTGCACTCA
>probe:Drosophila_2:1627401_at:316:429; Interrogation_Position=918; Antisense; GAGTCTGGAGCCTCTATTGCAAAGT
>probe:Drosophila_2:1627401_at:197:85; Interrogation_Position=940; Antisense; AGTGATGACAATCGCGAGGCCTTGA
>probe:Drosophila_2:1627401_at:559:439; Interrogation_Position=955; Antisense; GAGGCCTTGAATGCCGCTCAAGTTG
>probe:Drosophila_2:1627401_at:702:441; Interrogation_Position=982; Antisense; GATGTTGAGCGTTTTCTTCGTGAAC

Paste this into a BLAST search page for me
GTGGGCCAACCGATTGAACCGTGAGGGCTACCAGCTAACCGGAGTTTGAAGATGCGATGGAAGAACCGCCCTTGCGTATACAGACATTCGATTTGGCAGCATTTGGCAGCTGTTTTACGCCTACATACATGGCGCCGAAGCAGTGGACAAAAGTTCTAAGTTGCCCATCGAGACGTACTGGAGCATTTGCATTCGGCGCAAATTCTACGAATCCTTGTCCTCTTTGTAGGACTTCATTCTGGTGCACTCAGAGTCTGGAGCCTCTATTGCAAAGTAGTGATGACAATCGCGAGGCCTTGAGAGGCCTTGAATGCCGCTCAAGTTGGATGTTGAGCGTTTTCTTCGTGAAC

Full Affymetrix probeset data:

Annotations for 1627401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720