Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627402_a_at:

>probe:Drosophila_2:1627402_a_at:528:287; Interrogation_Position=105; Antisense; CTGGCGCTTTGTCGCGTGCCGCTTA
>probe:Drosophila_2:1627402_a_at:319:505; Interrogation_Position=120; Antisense; GTGCCGCTTACCACGGTGGACATGG
>probe:Drosophila_2:1627402_a_at:472:671; Interrogation_Position=128; Antisense; TACCACGGTGGACATGGTCCCCACT
>probe:Drosophila_2:1627402_a_at:719:137; Interrogation_Position=162; Antisense; ACGATCTGCCCGTGCCCGCTGGAGA
>probe:Drosophila_2:1627402_a_at:633:303; Interrogation_Position=171; Antisense; CCGTGCCCGCTGGAGACTGGAAGGA
>probe:Drosophila_2:1627402_a_at:188:473; Interrogation_Position=20; Antisense; GTTCAACACAAGGTAATCTTCGGCT
>probe:Drosophila_2:1627402_a_at:684:107; Interrogation_Position=210; Antisense; AGAACGCCAAGTACAATGCCGCGCT
>probe:Drosophila_2:1627402_a_at:553:665; Interrogation_Position=221; Antisense; TACAATGCCGCGCTCATCACTGGCA
>probe:Drosophila_2:1627402_a_at:380:647; Interrogation_Position=234; Antisense; TCATCACTGGCATTCTCGTCCTGGC
>probe:Drosophila_2:1627402_a_at:393:631; Interrogation_Position=252; Antisense; TCCTGGCCGGCACTATTGGATTCGT
>probe:Drosophila_2:1627402_a_at:493:491; Interrogation_Position=32; Antisense; GTAATCTTCGGCTACTTTCGAGCAA
>probe:Drosophila_2:1627402_a_at:515:639; Interrogation_Position=39; Antisense; TCGGCTACTTTCGAGCAATCATGTT
>probe:Drosophila_2:1627402_a_at:655:291; Interrogation_Position=50; Antisense; CGAGCAATCATGTTGGTTAAGCACA
>probe:Drosophila_2:1627402_a_at:712:465; Interrogation_Position=61; Antisense; GTTGGTTAAGCACATTGTCAAGCAG

Paste this into a BLAST search page for me
CTGGCGCTTTGTCGCGTGCCGCTTAGTGCCGCTTACCACGGTGGACATGGTACCACGGTGGACATGGTCCCCACTACGATCTGCCCGTGCCCGCTGGAGACCGTGCCCGCTGGAGACTGGAAGGAGTTCAACACAAGGTAATCTTCGGCTAGAACGCCAAGTACAATGCCGCGCTTACAATGCCGCGCTCATCACTGGCATCATCACTGGCATTCTCGTCCTGGCTCCTGGCCGGCACTATTGGATTCGTGTAATCTTCGGCTACTTTCGAGCAATCGGCTACTTTCGAGCAATCATGTTCGAGCAATCATGTTGGTTAAGCACAGTTGGTTAAGCACATTGTCAAGCAG

Full Affymetrix probeset data:

Annotations for 1627402_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime