FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627405_at:

>probe:Drosophila_2:1627405_at:436:379; Interrogation_Position=124; Antisense; GAAGCCAGTCCGATTTCAGTCGATA
>probe:Drosophila_2:1627405_at:245:51; Interrogation_Position=13; Antisense; ATGCGCCGCTTGTTTACATCGGTCA
>probe:Drosophila_2:1627405_at:210:617; Interrogation_Position=163; Antisense; TGCATACAAATCCTTGCCAAGCCGG
>probe:Drosophila_2:1627405_at:113:383; Interrogation_Position=198; Antisense; GAACGGAATCACAGGAATTGGCTTT
>probe:Drosophila_2:1627405_at:168:341; Interrogation_Position=218; Antisense; GCTTTGAAGGAGTGGGCGTCCAAAT
>probe:Drosophila_2:1627405_at:108:685; Interrogation_Position=26; Antisense; TTACATCGGTCAACGCCCAAATAAT
>probe:Drosophila_2:1627405_at:556:373; Interrogation_Position=265; Antisense; GAAGCTAACGCCGAACTGGTCAAGT
>probe:Drosophila_2:1627405_at:391:479; Interrogation_Position=288; Antisense; GTTTCTGTCGAAAGTTCTAGGTCTT
>probe:Drosophila_2:1627405_at:664:391; Interrogation_Position=314; Antisense; GAAAGAGCGACGTTTCTTTGGACAA
>probe:Drosophila_2:1627405_at:600:277; Interrogation_Position=329; Antisense; CTTTGGACAAGGGATCTCGATCGCG
>probe:Drosophila_2:1627405_at:597:659; Interrogation_Position=371; Antisense; TAACCAAGGGAGTGTCCACGGTGGA
>probe:Drosophila_2:1627405_at:333:119; Interrogation_Position=407; Antisense; AGCTGCTGCGCAAAGAATCCGATTC
>probe:Drosophila_2:1627405_at:333:257; Interrogation_Position=71; Antisense; CAAAGGCCGGCGTTGAAAGTGCGAA
>probe:Drosophila_2:1627405_at:558:197; Interrogation_Position=97; Antisense; AACGATGCAAAAGCGATGCCGGCTA

Paste this into a BLAST search page for me
GAAGCCAGTCCGATTTCAGTCGATAATGCGCCGCTTGTTTACATCGGTCATGCATACAAATCCTTGCCAAGCCGGGAACGGAATCACAGGAATTGGCTTTGCTTTGAAGGAGTGGGCGTCCAAATTTACATCGGTCAACGCCCAAATAATGAAGCTAACGCCGAACTGGTCAAGTGTTTCTGTCGAAAGTTCTAGGTCTTGAAAGAGCGACGTTTCTTTGGACAACTTTGGACAAGGGATCTCGATCGCGTAACCAAGGGAGTGTCCACGGTGGAAGCTGCTGCGCAAAGAATCCGATTCCAAAGGCCGGCGTTGAAAGTGCGAAAACGATGCAAAAGCGATGCCGGCTA

Full Affymetrix probeset data:

Annotations for 1627405_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720