Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627406_at:

>probe:Drosophila_2:1627406_at:63:31; Interrogation_Position=1910; Antisense; ATAAGTTGCAGTTACGGCTCCGCTA
>probe:Drosophila_2:1627406_at:118:529; Interrogation_Position=1935; Antisense; GGGAGTCGCAATCCTAGCTAACTTA
>probe:Drosophila_2:1627406_at:214:475; Interrogation_Position=1984; Antisense; GTTATGCATGTACCGTGTTCACTAG
>probe:Drosophila_2:1627406_at:610:467; Interrogation_Position=2008; Antisense; GTTGACCATTTGACCATTTGACAGT
>probe:Drosophila_2:1627406_at:154:193; Interrogation_Position=2048; Antisense; AACTCACTGAGAATTCGCATGCCTG
>probe:Drosophila_2:1627406_at:218:299; Interrogation_Position=2073; Antisense; CGCTCTTCCTTTCCGGTAAATGAAT
>probe:Drosophila_2:1627406_at:709:83; Interrogation_Position=2147; Antisense; AGTGGCAGTATCAGCCGTCGGAGAA
>probe:Drosophila_2:1627406_at:407:549; Interrogation_Position=2166; Antisense; GGAGAAGTATGTGCCCAGCCAGCCG
>probe:Drosophila_2:1627406_at:712:379; Interrogation_Position=2192; Antisense; GAACCTCATCCTAAATGGGCAACGT
>probe:Drosophila_2:1627406_at:197:199; Interrogation_Position=2212; Antisense; AACGTTGACGACCTGGACCAGCTGA
>probe:Drosophila_2:1627406_at:586:363; Interrogation_Position=2247; Antisense; GAATCGGTTACAAATCTACACGGCA
>probe:Drosophila_2:1627406_at:430:659; Interrogation_Position=2263; Antisense; TACACGGCATTAGCTTATCGCCTAG
>probe:Drosophila_2:1627406_at:720:683; Interrogation_Position=2278; Antisense; TATCGCCTAGCTATAGTTATCCTCG
>probe:Drosophila_2:1627406_at:340:475; Interrogation_Position=2293; Antisense; GTTATCCTCGATTGCAATTCTTAAA

Paste this into a BLAST search page for me
ATAAGTTGCAGTTACGGCTCCGCTAGGGAGTCGCAATCCTAGCTAACTTAGTTATGCATGTACCGTGTTCACTAGGTTGACCATTTGACCATTTGACAGTAACTCACTGAGAATTCGCATGCCTGCGCTCTTCCTTTCCGGTAAATGAATAGTGGCAGTATCAGCCGTCGGAGAAGGAGAAGTATGTGCCCAGCCAGCCGGAACCTCATCCTAAATGGGCAACGTAACGTTGACGACCTGGACCAGCTGAGAATCGGTTACAAATCTACACGGCATACACGGCATTAGCTTATCGCCTAGTATCGCCTAGCTATAGTTATCCTCGGTTATCCTCGATTGCAATTCTTAAA

Full Affymetrix probeset data:

Annotations for 1627406_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime