FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627407_at:

>probe:Drosophila_2:1627407_at:684:389; Interrogation_Position=109; Antisense; GAAACATTCCGACAAACCACACAAG
>probe:Drosophila_2:1627407_at:176:375; Interrogation_Position=136; Antisense; GAAGACCCACGATCCGCTCAAGAAA
>probe:Drosophila_2:1627407_at:311:525; Interrogation_Position=171; Antisense; GGGCTCTAAAGAAGCTCCGCCGCAA
>probe:Drosophila_2:1627407_at:330:613; Interrogation_Position=207; Antisense; TGAATTTCCCGTACCAACTCTTCTT
>probe:Drosophila_2:1627407_at:232:215; Interrogation_Position=293; Antisense; AAGATAGTGCTTACCTCCCAACTAA
>probe:Drosophila_2:1627407_at:368:303; Interrogation_Position=345; Antisense; CCGATTGCAGCGTGGACGAGCTTAA
>probe:Drosophila_2:1627407_at:135:711; Interrogation_Position=366; Antisense; TTAAGGAACTCAGCCGCGAGGTGCA
>probe:Drosophila_2:1627407_at:13:107; Interrogation_Position=396; Antisense; AGAAACGCCTCTGCCATCAAGTGGA
>probe:Drosophila_2:1627407_at:477:187; Interrogation_Position=42; Antisense; AACACACCATGATTGACCAGCACAA
>probe:Drosophila_2:1627407_at:691:109; Interrogation_Position=429; Antisense; AGCAATTCCGGCAACTGGGACTCAC
>probe:Drosophila_2:1627407_at:592:593; Interrogation_Position=444; Antisense; TGGGACTCACCGAGATGATCCTCAA
>probe:Drosophila_2:1627407_at:197:211; Interrogation_Position=476; Antisense; AAGACGACGCTGTAACCTGTGGAAT
>probe:Drosophila_2:1627407_at:576:183; Interrogation_Position=510; Antisense; AAAAGTCGGATTGAGCAGGCTGTTA
>probe:Drosophila_2:1627407_at:208:423; Interrogation_Position=83; Antisense; GAGAAATCCAGTCGCAAGTCGGGAA

Paste this into a BLAST search page for me
GAAACATTCCGACAAACCACACAAGGAAGACCCACGATCCGCTCAAGAAAGGGCTCTAAAGAAGCTCCGCCGCAATGAATTTCCCGTACCAACTCTTCTTAAGATAGTGCTTACCTCCCAACTAACCGATTGCAGCGTGGACGAGCTTAATTAAGGAACTCAGCCGCGAGGTGCAAGAAACGCCTCTGCCATCAAGTGGAAACACACCATGATTGACCAGCACAAAGCAATTCCGGCAACTGGGACTCACTGGGACTCACCGAGATGATCCTCAAAAGACGACGCTGTAACCTGTGGAATAAAAGTCGGATTGAGCAGGCTGTTAGAGAAATCCAGTCGCAAGTCGGGAA

Full Affymetrix probeset data:

Annotations for 1627407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720