FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627409_at:

>probe:Drosophila_2:1627409_at:349:549; Interrogation_Position=1005; Antisense; GGAGGACTATTACCAGAGCTTTTTA
>probe:Drosophila_2:1627409_at:351:265; Interrogation_Position=1018; Antisense; CAGAGCTTTTTACGCTTACACGAAA
>probe:Drosophila_2:1627409_at:595:117; Interrogation_Position=1130; Antisense; AGCTAGAGCCTTTTTATTGTGTATA
>probe:Drosophila_2:1627409_at:254:63; Interrogation_Position=595; Antisense; ATGTGGGTCTGCAAACGATTCCGTT
>probe:Drosophila_2:1627409_at:593:121; Interrogation_Position=625; Antisense; AGCGTATGGATTATCCGGCGTCTTT
>probe:Drosophila_2:1627409_at:255:439; Interrogation_Position=699; Antisense; GAGGCAGTTTACCAGCAGTGCATTC
>probe:Drosophila_2:1627409_at:481:117; Interrogation_Position=755; Antisense; AGCTCCCTCTGCTAAGTCCAATAAG
>probe:Drosophila_2:1627409_at:657:501; Interrogation_Position=770; Antisense; GTCCAATAAGGACGTTGCCCCTGCA
>probe:Drosophila_2:1627409_at:242:289; Interrogation_Position=799; Antisense; CGGAAAAACCAATTGCTGCCTCAGC
>probe:Drosophila_2:1627409_at:484:261; Interrogation_Position=823; Antisense; CAGCTGAACCTGATGAACTTGACGA
>probe:Drosophila_2:1627409_at:220:417; Interrogation_Position=846; Antisense; GAGCTATTGGCCATGACCGATACGC
>probe:Drosophila_2:1627409_at:347:457; Interrogation_Position=864; Antisense; GATACGCAACTGGATATAGGCTCTG
>probe:Drosophila_2:1627409_at:356:49; Interrogation_Position=900; Antisense; ATGCCAATGCCTATGGTGCAGCCGG
>probe:Drosophila_2:1627409_at:124:371; Interrogation_Position=963; Antisense; GAATGGCTGGATTCCGTTTTGGATG

Paste this into a BLAST search page for me
GGAGGACTATTACCAGAGCTTTTTACAGAGCTTTTTACGCTTACACGAAAAGCTAGAGCCTTTTTATTGTGTATAATGTGGGTCTGCAAACGATTCCGTTAGCGTATGGATTATCCGGCGTCTTTGAGGCAGTTTACCAGCAGTGCATTCAGCTCCCTCTGCTAAGTCCAATAAGGTCCAATAAGGACGTTGCCCCTGCACGGAAAAACCAATTGCTGCCTCAGCCAGCTGAACCTGATGAACTTGACGAGAGCTATTGGCCATGACCGATACGCGATACGCAACTGGATATAGGCTCTGATGCCAATGCCTATGGTGCAGCCGGGAATGGCTGGATTCCGTTTTGGATG

Full Affymetrix probeset data:

Annotations for 1627409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720