Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627410_at:

>probe:Drosophila_2:1627410_at:551:491; Interrogation_Position=2697; Antisense; GTAAAACATATCACTCGAGAGCTAG
>probe:Drosophila_2:1627410_at:149:437; Interrogation_Position=2749; Antisense; GAGGAGATAGCCAGCCTGAACCTTT
>probe:Drosophila_2:1627410_at:261:311; Interrogation_Position=2758; Antisense; GCCAGCCTGAACCTTTTGTATTTTG
>probe:Drosophila_2:1627410_at:480:169; Interrogation_Position=2849; Antisense; AAAGGCCAGATGTAATTCCTCTGTG
>probe:Drosophila_2:1627410_at:597:653; Interrogation_Position=2861; Antisense; TAATTCCTCTGTGGTCCCCGAAGTT
>probe:Drosophila_2:1627410_at:109:479; Interrogation_Position=2916; Antisense; GTTTAGCGATTACGTGTATCTTTAA
>probe:Drosophila_2:1627410_at:258:425; Interrogation_Position=2970; Antisense; GAGAGACTCGAACTAGCTACAGCTT
>probe:Drosophila_2:1627410_at:460:665; Interrogation_Position=2987; Antisense; TACAGCTTTATAACGCGAACACAAT
>probe:Drosophila_2:1627410_at:232:133; Interrogation_Position=2999; Antisense; ACGCGAACACAATCCAATAGTCACT
>probe:Drosophila_2:1627410_at:584:239; Interrogation_Position=3014; Antisense; AATAGTCACTAACCGATCGATTCGA
>probe:Drosophila_2:1627410_at:486:449; Interrogation_Position=3028; Antisense; GATCGATTCGATGTTTTTATTTTAT
>probe:Drosophila_2:1627410_at:421:465; Interrogation_Position=3060; Antisense; GATTGTAAATCACACGAAACCCGAA
>probe:Drosophila_2:1627410_at:4:249; Interrogation_Position=3087; Antisense; AATTGTTTAAATTGTGCACACACTG
>probe:Drosophila_2:1627410_at:357:179; Interrogation_Position=3146; Antisense; AAACACTTATTTATCGCATGAACAT

Paste this into a BLAST search page for me
GTAAAACATATCACTCGAGAGCTAGGAGGAGATAGCCAGCCTGAACCTTTGCCAGCCTGAACCTTTTGTATTTTGAAAGGCCAGATGTAATTCCTCTGTGTAATTCCTCTGTGGTCCCCGAAGTTGTTTAGCGATTACGTGTATCTTTAAGAGAGACTCGAACTAGCTACAGCTTTACAGCTTTATAACGCGAACACAATACGCGAACACAATCCAATAGTCACTAATAGTCACTAACCGATCGATTCGAGATCGATTCGATGTTTTTATTTTATGATTGTAAATCACACGAAACCCGAAAATTGTTTAAATTGTGCACACACTGAAACACTTATTTATCGCATGAACAT

Full Affymetrix probeset data:

Annotations for 1627410_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime