FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627411_at:

>probe:Drosophila_2:1627411_at:225:543; Interrogation_Position=577; Antisense; GGATAATGCTCAGATGCCTCCCTCA
>probe:Drosophila_2:1627411_at:484:633; Interrogation_Position=595; Antisense; TCCCTCATCGTACCAGAAGTGGAGA
>probe:Drosophila_2:1627411_at:535:423; Interrogation_Position=616; Antisense; GAGAAACTATCTGCAATCCACGCCA
>probe:Drosophila_2:1627411_at:381:495; Interrogation_Position=659; Antisense; GTCACCCACATTCCGGAGGCAATTG
>probe:Drosophila_2:1627411_at:58:719; Interrogation_Position=708; Antisense; TTCCGGGCTTCAGCGACCTGGAGGA
>probe:Drosophila_2:1627411_at:601:379; Interrogation_Position=776; Antisense; GAACCACTGGAGGAGCCCATGTACA
>probe:Drosophila_2:1627411_at:172:61; Interrogation_Position=794; Antisense; ATGTACACCACCTACCAATTGCTAG
>probe:Drosophila_2:1627411_at:230:135; Interrogation_Position=827; Antisense; ACGCACACCATATCCACAGATCTGT
>probe:Drosophila_2:1627411_at:385:509; Interrogation_Position=850; Antisense; GTGAGGCGTGAAGACCCAACCAATC
>probe:Drosophila_2:1627411_at:15:591; Interrogation_Position=899; Antisense; TGGTTCGGCGATTGGTGTAGCCCAT
>probe:Drosophila_2:1627411_at:531:599; Interrogation_Position=914; Antisense; TGTAGCCCATCGATGTAATACCCGG
>probe:Drosophila_2:1627411_at:272:651; Interrogation_Position=929; Antisense; TAATACCCGGCGAGGACTGGCAACA
>probe:Drosophila_2:1627411_at:593:267; Interrogation_Position=952; Antisense; CAGGTGTGCCAGCTGTCAAACAGTT
>probe:Drosophila_2:1627411_at:157:167; Interrogation_Position=994; Antisense; AAATCCGCTACGATTGCATTGCCCA

Paste this into a BLAST search page for me
GGATAATGCTCAGATGCCTCCCTCATCCCTCATCGTACCAGAAGTGGAGAGAGAAACTATCTGCAATCCACGCCAGTCACCCACATTCCGGAGGCAATTGTTCCGGGCTTCAGCGACCTGGAGGAGAACCACTGGAGGAGCCCATGTACAATGTACACCACCTACCAATTGCTAGACGCACACCATATCCACAGATCTGTGTGAGGCGTGAAGACCCAACCAATCTGGTTCGGCGATTGGTGTAGCCCATTGTAGCCCATCGATGTAATACCCGGTAATACCCGGCGAGGACTGGCAACACAGGTGTGCCAGCTGTCAAACAGTTAAATCCGCTACGATTGCATTGCCCA

Full Affymetrix probeset data:

Annotations for 1627411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720