Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627413_at:

>probe:Drosophila_2:1627413_at:313:211; Interrogation_Position=3865; Antisense; AAGACCCCGTCGAATAATGTCCATA
>probe:Drosophila_2:1627413_at:395:653; Interrogation_Position=3879; Antisense; TAATGTCCATACCAACCTTTCAGTT
>probe:Drosophila_2:1627413_at:328:649; Interrogation_Position=3898; Antisense; TCAGTTTTAGGTGGCGAGCTGCTCT
>probe:Drosophila_2:1627413_at:477:121; Interrogation_Position=3968; Antisense; AGCGGCATGCCAGATCCTTGGACGA
>probe:Drosophila_2:1627413_at:622:39; Interrogation_Position=3992; Antisense; ATCTGGACAGGATTACGGCTGCTCC
>probe:Drosophila_2:1627413_at:201:127; Interrogation_Position=4017; Antisense; ACCAATTTCTAGTACGCCCAAGGCA
>probe:Drosophila_2:1627413_at:667:177; Interrogation_Position=4042; Antisense; AAACTGAGCCGCGAGGTGACCTATG
>probe:Drosophila_2:1627413_at:131:199; Interrogation_Position=4108; Antisense; AACGAGCATGATGTCTATGTGCAAC
>probe:Drosophila_2:1627413_at:428:411; Interrogation_Position=4159; Antisense; GACCACGACCAAACGGATTCCGATG
>probe:Drosophila_2:1627413_at:146:463; Interrogation_Position=4174; Antisense; GATTCCGATGTCTACGAGGTCCTGC
>probe:Drosophila_2:1627413_at:177:77; Interrogation_Position=4202; Antisense; AGGAGACCGCCTCGAATTTGTCACA
>probe:Drosophila_2:1627413_at:138:45; Interrogation_Position=4244; Antisense; ATCGCGAGACCATCCGTCAGTGGGA
>probe:Drosophila_2:1627413_at:511:593; Interrogation_Position=4264; Antisense; TGGGATGCCATGTCGAGTGGCCTAA
>probe:Drosophila_2:1627413_at:350:505; Interrogation_Position=4357; Antisense; GTGCGCTCCATAGTTCAGCAGTTGA

Paste this into a BLAST search page for me
AAGACCCCGTCGAATAATGTCCATATAATGTCCATACCAACCTTTCAGTTTCAGTTTTAGGTGGCGAGCTGCTCTAGCGGCATGCCAGATCCTTGGACGAATCTGGACAGGATTACGGCTGCTCCACCAATTTCTAGTACGCCCAAGGCAAAACTGAGCCGCGAGGTGACCTATGAACGAGCATGATGTCTATGTGCAACGACCACGACCAAACGGATTCCGATGGATTCCGATGTCTACGAGGTCCTGCAGGAGACCGCCTCGAATTTGTCACAATCGCGAGACCATCCGTCAGTGGGATGGGATGCCATGTCGAGTGGCCTAAGTGCGCTCCATAGTTCAGCAGTTGA

Full Affymetrix probeset data:

Annotations for 1627413_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime