Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627416_at:

>probe:Drosophila_2:1627416_at:688:727; Interrogation_Position=1162; Antisense; TTGGCGTTTGTCGAGCTGAAATTGC
>probe:Drosophila_2:1627416_at:430:335; Interrogation_Position=1176; Antisense; GCTGAAATTGCTGCATTTGCCTAAT
>probe:Drosophila_2:1627416_at:486:205; Interrogation_Position=1211; Antisense; AAGCGGGCACCGTAGACAGCGATGA
>probe:Drosophila_2:1627416_at:339:421; Interrogation_Position=691; Antisense; GAGCACGGCCACCTGGACAATGATG
>probe:Drosophila_2:1627416_at:696:83; Interrogation_Position=730; Antisense; AGTGGCACAGGAACTTTGTCCGCGT
>probe:Drosophila_2:1627416_at:488:299; Interrogation_Position=750; Antisense; CGCGTGCCTGCAGCAAATTCGAGGT
>probe:Drosophila_2:1627416_at:658:245; Interrogation_Position=765; Antisense; AATTCGAGGTCGCAATTGTCGGATT
>probe:Drosophila_2:1627416_at:283:593; Interrogation_Position=791; Antisense; TGGGTCTCCGTTTGCAGTGTCGACT
>probe:Drosophila_2:1627416_at:603:515; Interrogation_Position=807; Antisense; GTGTCGACTGGATGACTGCCTGCCA
>probe:Drosophila_2:1627416_at:362:371; Interrogation_Position=843; Antisense; GAAGGAGGTATTCCGGCTGCAATCC
>probe:Drosophila_2:1627416_at:69:617; Interrogation_Position=860; Antisense; TGCAATCCTTTGCTTGGCACTCGCA
>probe:Drosophila_2:1627416_at:429:145; Interrogation_Position=878; Antisense; ACTCGCAGCTGACGGTGCACTATGA
>probe:Drosophila_2:1627416_at:175:141; Interrogation_Position=911; Antisense; ACGGGAGCGTCAAGTGGATGCCACA
>probe:Drosophila_2:1627416_at:652:361; Interrogation_Position=997; Antisense; GAATTGAATTTCACGCGTAACGCAC

Paste this into a BLAST search page for me
TTGGCGTTTGTCGAGCTGAAATTGCGCTGAAATTGCTGCATTTGCCTAATAAGCGGGCACCGTAGACAGCGATGAGAGCACGGCCACCTGGACAATGATGAGTGGCACAGGAACTTTGTCCGCGTCGCGTGCCTGCAGCAAATTCGAGGTAATTCGAGGTCGCAATTGTCGGATTTGGGTCTCCGTTTGCAGTGTCGACTGTGTCGACTGGATGACTGCCTGCCAGAAGGAGGTATTCCGGCTGCAATCCTGCAATCCTTTGCTTGGCACTCGCAACTCGCAGCTGACGGTGCACTATGAACGGGAGCGTCAAGTGGATGCCACAGAATTGAATTTCACGCGTAACGCAC

Full Affymetrix probeset data:

Annotations for 1627416_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime