FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627419_at:

>probe:Drosophila_2:1627419_at:439:273; Interrogation_Position=16; Antisense; CATTTTGCGAAAGGTATTTTGAGGT
>probe:Drosophila_2:1627419_at:455:15; Interrogation_Position=31; Antisense; ATTTTGAGGTGTGCGAGATCTGGTC
>probe:Drosophila_2:1627419_at:273:81; Interrogation_Position=37; Antisense; AGGTGTGCGAGATCTGGTCACGCTC
>probe:Drosophila_2:1627419_at:455:515; Interrogation_Position=39; Antisense; GTGTGCGAGATCTGGTCACGCTCAC
>probe:Drosophila_2:1627419_at:266:623; Interrogation_Position=42; Antisense; TGCGAGATCTGGTCACGCTCACAAG
>probe:Drosophila_2:1627419_at:441:427; Interrogation_Position=45; Antisense; GAGATCTGGTCACGCTCACAAGCAA
>probe:Drosophila_2:1627419_at:207:41; Interrogation_Position=48; Antisense; ATCTGGTCACGCTCACAAGCAATTT
>probe:Drosophila_2:1627419_at:297:537; Interrogation_Position=52; Antisense; GGTCACGCTCACAAGCAATTTTCTG
>probe:Drosophila_2:1627419_at:138:261; Interrogation_Position=55; Antisense; CACGCTCACAAGCAATTTTCTGGAG
>probe:Drosophila_2:1627419_at:245:651; Interrogation_Position=60; Antisense; TCACAAGCAATTTTCTGGAGATTTC
>probe:Drosophila_2:1627419_at:503:361; Interrogation_Position=66; Antisense; GCAATTTTCTGGAGATTTCTTGAAC
>probe:Drosophila_2:1627419_at:283:689; Interrogation_Position=71; Antisense; TTTCTGGAGATTTCTTGAACCAACT
>probe:Drosophila_2:1627419_at:128:551; Interrogation_Position=76; Antisense; GGAGATTTCTTGAACCAACTTTACG
>probe:Drosophila_2:1627419_at:20:459; Interrogation_Position=79; Antisense; GATTTCTTGAACCAACTTTACGAAG

Paste this into a BLAST search page for me
CATTTTGCGAAAGGTATTTTGAGGTATTTTGAGGTGTGCGAGATCTGGTCAGGTGTGCGAGATCTGGTCACGCTCGTGTGCGAGATCTGGTCACGCTCACTGCGAGATCTGGTCACGCTCACAAGGAGATCTGGTCACGCTCACAAGCAAATCTGGTCACGCTCACAAGCAATTTGGTCACGCTCACAAGCAATTTTCTGCACGCTCACAAGCAATTTTCTGGAGTCACAAGCAATTTTCTGGAGATTTCGCAATTTTCTGGAGATTTCTTGAACTTTCTGGAGATTTCTTGAACCAACTGGAGATTTCTTGAACCAACTTTACGGATTTCTTGAACCAACTTTACGAAG

Full Affymetrix probeset data:

Annotations for 1627419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720