FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627421_at:

>probe:Drosophila_2:1627421_at:522:257; Interrogation_Position=1226; Antisense; CACATCAACTTAATGGCCCTCGGGC
>probe:Drosophila_2:1627421_at:537:639; Interrogation_Position=1245; Antisense; TCGGGCCGCCGGACCATAGTTAAAG
>probe:Drosophila_2:1627421_at:643:403; Interrogation_Position=1278; Antisense; GACTAGCTCAGGTTACAATCGGTTA
>probe:Drosophila_2:1627421_at:457:675; Interrogation_Position=1323; Antisense; TAGCTGCAGCCCAAGTTATTGGACT
>probe:Drosophila_2:1627421_at:376:3; Interrogation_Position=1340; Antisense; ATTGGACTTGTGTATCTCTACCGTA
>probe:Drosophila_2:1627421_at:48:643; Interrogation_Position=1354; Antisense; TCTCTACCGTATACCCATTAATTTG
>probe:Drosophila_2:1627421_at:694:483; Interrogation_Position=1378; Antisense; GTATCCGTTAATGCAAGACCCAGTT
>probe:Drosophila_2:1627421_at:44:725; Interrogation_Position=1401; Antisense; TTGCTCCTGTGTCTGCGTTAGTGAA
>probe:Drosophila_2:1627421_at:68:671; Interrogation_Position=1436; Antisense; TACGAGTATCTAATGGCAACCGCCG
>probe:Drosophila_2:1627421_at:336:133; Interrogation_Position=1454; Antisense; ACCGCCGTCGAGGATTTGCAGATAC
>probe:Drosophila_2:1627421_at:708:623; Interrogation_Position=1519; Antisense; TGCGAGTTTGTCACTGCCGGATAAA
>probe:Drosophila_2:1627421_at:178:663; Interrogation_Position=1540; Antisense; TAAAGCTGCTCCTCGTTATTTTAGA
>probe:Drosophila_2:1627421_at:650:205; Interrogation_Position=1635; Antisense; AAGCGAACAGTGTGCATGTCCAAGT
>probe:Drosophila_2:1627421_at:131:343; Interrogation_Position=1753; Antisense; GCATGTATACCAAACCGAAACCGAA

Paste this into a BLAST search page for me
CACATCAACTTAATGGCCCTCGGGCTCGGGCCGCCGGACCATAGTTAAAGGACTAGCTCAGGTTACAATCGGTTATAGCTGCAGCCCAAGTTATTGGACTATTGGACTTGTGTATCTCTACCGTATCTCTACCGTATACCCATTAATTTGGTATCCGTTAATGCAAGACCCAGTTTTGCTCCTGTGTCTGCGTTAGTGAATACGAGTATCTAATGGCAACCGCCGACCGCCGTCGAGGATTTGCAGATACTGCGAGTTTGTCACTGCCGGATAAATAAAGCTGCTCCTCGTTATTTTAGAAAGCGAACAGTGTGCATGTCCAAGTGCATGTATACCAAACCGAAACCGAA

Full Affymetrix probeset data:

Annotations for 1627421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720