FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627423_at:

>probe:Drosophila_2:1627423_at:314:295; Interrogation_Position=1461; Antisense; CGAGCGCGGCGAGCTTTGTTTTAAA
>probe:Drosophila_2:1627423_at:179:325; Interrogation_Position=1487; Antisense; GCGACGGCATCATGAAGGGCTACAT
>probe:Drosophila_2:1627423_at:672:427; Interrogation_Position=1514; Antisense; GAGATACGAAGTCCACGCAGACCGC
>probe:Drosophila_2:1627423_at:107:301; Interrogation_Position=1536; Antisense; CGCCATCAAGGACGGTTGGTTGCAT
>probe:Drosophila_2:1627423_at:76:345; Interrogation_Position=1557; Antisense; GCATACTGGCGATATTGGCTACTAT
>probe:Drosophila_2:1627423_at:398:461; Interrogation_Position=1588; Antisense; GATTTTGAGTTCTTCATCGTGGACC
>probe:Drosophila_2:1627423_at:686:29; Interrogation_Position=1632; Antisense; ATACAAGGGATACCAGGTGCCGCCG
>probe:Drosophila_2:1627423_at:290:101; Interrogation_Position=1659; Antisense; AGAGATTGAGGCTCTGCTGCTCACC
>probe:Drosophila_2:1627423_at:651:621; Interrogation_Position=1673; Antisense; TGCTGCTCACCAACGACAAGATTAA
>probe:Drosophila_2:1627423_at:593:283; Interrogation_Position=1741; Antisense; CTGCCGCTGGCATTTGTGGTCAAAC
>probe:Drosophila_2:1627423_at:53:137; Interrogation_Position=1790; Antisense; ACGAAGTCATTCAGTTTGTCAACGA
>probe:Drosophila_2:1627423_at:426:381; Interrogation_Position=1875; Antisense; GAACCCCAGTGGCAAGATTCTGCGT
>probe:Drosophila_2:1627423_at:652:11; Interrogation_Position=1891; Antisense; ATTCTGCGTCGCATTCTGCGGGAAA
>probe:Drosophila_2:1627423_at:420:541; Interrogation_Position=1946; Antisense; GGATTTCTCCCCTTAAGGGTGTGTG

Paste this into a BLAST search page for me
CGAGCGCGGCGAGCTTTGTTTTAAAGCGACGGCATCATGAAGGGCTACATGAGATACGAAGTCCACGCAGACCGCCGCCATCAAGGACGGTTGGTTGCATGCATACTGGCGATATTGGCTACTATGATTTTGAGTTCTTCATCGTGGACCATACAAGGGATACCAGGTGCCGCCGAGAGATTGAGGCTCTGCTGCTCACCTGCTGCTCACCAACGACAAGATTAACTGCCGCTGGCATTTGTGGTCAAACACGAAGTCATTCAGTTTGTCAACGAGAACCCCAGTGGCAAGATTCTGCGTATTCTGCGTCGCATTCTGCGGGAAAGGATTTCTCCCCTTAAGGGTGTGTG

Full Affymetrix probeset data:

Annotations for 1627423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720