FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627426_at:

>probe:Drosophila_2:1627426_at:593:381; Interrogation_Position=1007; Antisense; GACAGGGAAACGATTCCACGCGGAC
>probe:Drosophila_2:1627426_at:277:555; Interrogation_Position=1028; Antisense; GGACCCGACTCTAATGCAGATCTTG
>probe:Drosophila_2:1627426_at:188:321; Interrogation_Position=1133; Antisense; GCCCCATCTGATCCTAAGTCAGCAA
>probe:Drosophila_2:1627426_at:502:217; Interrogation_Position=1148; Antisense; AAGTCAGCAATTATTTCGCAAGTTA
>probe:Drosophila_2:1627426_at:164:685; Interrogation_Position=1209; Antisense; TATATGTAGGCACACGACCTTCTCG
>probe:Drosophila_2:1627426_at:538:603; Interrogation_Position=1238; Antisense; TGATTCCACGTCAAATCCCCGTAAA
>probe:Drosophila_2:1627426_at:397:665; Interrogation_Position=1269; Antisense; TAAATTCCCTTGACTACTGGCAGCC
>probe:Drosophila_2:1627426_at:423:187; Interrogation_Position=1296; Antisense; AACACCAACACAGCTGTACGTGACT
>probe:Drosophila_2:1627426_at:271:293; Interrogation_Position=806; Antisense; CGTTTCACGCATTTCGTCACAAAAT
>probe:Drosophila_2:1627426_at:722:551; Interrogation_Position=847; Antisense; GGAGAATCTGATCGTGCCCATCAAC
>probe:Drosophila_2:1627426_at:571:175; Interrogation_Position=880; Antisense; AAACGCGGCCCCTGGCGAAAGCGAG
>probe:Drosophila_2:1627426_at:241:681; Interrogation_Position=908; Antisense; TAGGAGCCCGCCCAGATTAGTCAGA
>probe:Drosophila_2:1627426_at:57:89; Interrogation_Position=926; Antisense; AGTCAGACTCGCATGAAACACTCAT
>probe:Drosophila_2:1627426_at:313:117; Interrogation_Position=980; Antisense; AGCTTGCAAGTTGGGTTGGCTCACC

Paste this into a BLAST search page for me
GACAGGGAAACGATTCCACGCGGACGGACCCGACTCTAATGCAGATCTTGGCCCCATCTGATCCTAAGTCAGCAAAAGTCAGCAATTATTTCGCAAGTTATATATGTAGGCACACGACCTTCTCGTGATTCCACGTCAAATCCCCGTAAATAAATTCCCTTGACTACTGGCAGCCAACACCAACACAGCTGTACGTGACTCGTTTCACGCATTTCGTCACAAAATGGAGAATCTGATCGTGCCCATCAACAAACGCGGCCCCTGGCGAAAGCGAGTAGGAGCCCGCCCAGATTAGTCAGAAGTCAGACTCGCATGAAACACTCATAGCTTGCAAGTTGGGTTGGCTCACC

Full Affymetrix probeset data:

Annotations for 1627426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720