FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627430_at:

>probe:Drosophila_2:1627430_at:85:381; Interrogation_Position=1138; Antisense; GAACCAGCTTTCCTCGGAGCAGAAG
>probe:Drosophila_2:1627430_at:231:325; Interrogation_Position=1173; Antisense; GCGAGGATTACTACGAGGCGGCCAT
>probe:Drosophila_2:1627430_at:410:647; Interrogation_Position=1257; Antisense; TCATCGATGCCGTGACCAGGACCTT
>probe:Drosophila_2:1627430_at:224:123; Interrogation_Position=1313; Antisense; AGCGAGCGACTGCAGATCTTCCTAG
>probe:Drosophila_2:1627430_at:690:97; Interrogation_Position=1386; Antisense; AGAAGTTCGTCTACTGACCAACCTC
>probe:Drosophila_2:1627430_at:346:713; Interrogation_Position=1413; Antisense; TTCACCGTCCATCGCCAAAGATAAG
>probe:Drosophila_2:1627430_at:504:655; Interrogation_Position=1434; Antisense; TAAGAATCTCCATCGAAACGGCCCG
>probe:Drosophila_2:1627430_at:597:455; Interrogation_Position=1491; Antisense; GATTTGCCTCGAAATCCAAACCCTG
>probe:Drosophila_2:1627430_at:570:507; Interrogation_Position=1523; Antisense; GTGCGCGTGAAGGACACCCAGAAAG
>probe:Drosophila_2:1627430_at:335:195; Interrogation_Position=1549; Antisense; AACTGTAGCCAGGAGCACTGTTCAA
>probe:Drosophila_2:1627430_at:720:501; Interrogation_Position=1586; Antisense; GTCGATGAGCATTTACGTCCTTCTC
>probe:Drosophila_2:1627430_at:465:503; Interrogation_Position=1602; Antisense; GTCCTTCTCTCGATTATTCTCATGA
>probe:Drosophila_2:1627430_at:585:9; Interrogation_Position=1617; Antisense; ATTCTCATGATTTTCCCTTTACGGA
>probe:Drosophila_2:1627430_at:666:691; Interrogation_Position=1635; Antisense; TTACGGAGGCGTCTGCATAATATTA

Paste this into a BLAST search page for me
GAACCAGCTTTCCTCGGAGCAGAAGGCGAGGATTACTACGAGGCGGCCATTCATCGATGCCGTGACCAGGACCTTAGCGAGCGACTGCAGATCTTCCTAGAGAAGTTCGTCTACTGACCAACCTCTTCACCGTCCATCGCCAAAGATAAGTAAGAATCTCCATCGAAACGGCCCGGATTTGCCTCGAAATCCAAACCCTGGTGCGCGTGAAGGACACCCAGAAAGAACTGTAGCCAGGAGCACTGTTCAAGTCGATGAGCATTTACGTCCTTCTCGTCCTTCTCTCGATTATTCTCATGAATTCTCATGATTTTCCCTTTACGGATTACGGAGGCGTCTGCATAATATTA

Full Affymetrix probeset data:

Annotations for 1627430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720