FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627431_at:

>probe:Drosophila_2:1627431_at:480:1; Interrogation_Position=3695; Antisense; AACTTTGACTCCACGATAACCCCAT
>probe:Drosophila_2:1627431_at:441:85; Interrogation_Position=3766; Antisense; AGTGCAGCTCTTGATGTAACCATAA
>probe:Drosophila_2:1627431_at:482:267; Interrogation_Position=3786; Antisense; CATAAACTCAGTCGATTGCTCAGAT
>probe:Drosophila_2:1627431_at:728:463; Interrogation_Position=3799; Antisense; GATTGCTCAGATTTGTCTTGCTAGA
>probe:Drosophila_2:1627431_at:586:495; Interrogation_Position=3850; Antisense; GTCTTCTTTTTGTACGTATACGGAT
>probe:Drosophila_2:1627431_at:244:481; Interrogation_Position=3865; Antisense; GTATACGGATTTTGTACTTTCTTAT
>probe:Drosophila_2:1627431_at:320:15; Interrogation_Position=3924; Antisense; ATTTATCTGCACCTTTGCCAAACGA
>probe:Drosophila_2:1627431_at:367:257; Interrogation_Position=3950; Antisense; CAAATGCGAGCTGTTTGGCTGGAAA
>probe:Drosophila_2:1627431_at:489:679; Interrogation_Position=3989; Antisense; TAGTCTGCTAATGCATTCCATGCTG
>probe:Drosophila_2:1627431_at:399:619; Interrogation_Position=4000; Antisense; TGCATTCCATGCTGTTGTAAAAACT
>probe:Drosophila_2:1627431_at:42:165; Interrogation_Position=4039; Antisense; AAATCGCGCCTAAATACTATTTTAT
>probe:Drosophila_2:1627431_at:513:403; Interrogation_Position=4075; Antisense; GACGGATCTATAACCCAAATAACCA
>probe:Drosophila_2:1627431_at:633:15; Interrogation_Position=4107; Antisense; ATTATCTCAAACGTTCTGTATCTTA
>probe:Drosophila_2:1627431_at:538:179; Interrogation_Position=4131; Antisense; AAAAATCTCTCAACGTACTCTGAAA

Paste this into a BLAST search page for me
AACTTTGACTCCACGATAACCCCATAGTGCAGCTCTTGATGTAACCATAACATAAACTCAGTCGATTGCTCAGATGATTGCTCAGATTTGTCTTGCTAGAGTCTTCTTTTTGTACGTATACGGATGTATACGGATTTTGTACTTTCTTATATTTATCTGCACCTTTGCCAAACGACAAATGCGAGCTGTTTGGCTGGAAATAGTCTGCTAATGCATTCCATGCTGTGCATTCCATGCTGTTGTAAAAACTAAATCGCGCCTAAATACTATTTTATGACGGATCTATAACCCAAATAACCAATTATCTCAAACGTTCTGTATCTTAAAAAATCTCTCAACGTACTCTGAAA

Full Affymetrix probeset data:

Annotations for 1627431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720