FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627432_at:

>probe:Drosophila_2:1627432_at:437:497; Interrogation_Position=1004; Antisense; GTCATCGCATAGGTCCGCCAAATAG
>probe:Drosophila_2:1627432_at:122:141; Interrogation_Position=528; Antisense; ACTGTAACGGCCCTGGCGTTGAACA
>probe:Drosophila_2:1627432_at:410:579; Interrogation_Position=562; Antisense; TGGCCACAAACACCGATTGCCTGAT
>probe:Drosophila_2:1627432_at:577:89; Interrogation_Position=624; Antisense; AGTAGTAATACTCTGCAGGCCGCGA
>probe:Drosophila_2:1627432_at:238:407; Interrogation_Position=647; Antisense; GACGGTGCCCATAGTGTCGTATACA
>probe:Drosophila_2:1627432_at:158:501; Interrogation_Position=662; Antisense; GTCGTATACAACCTGTCGCATTTCA
>probe:Drosophila_2:1627432_at:180:29; Interrogation_Position=686; Antisense; ATACAATTCGATTCCGGTTTCCCAG
>probe:Drosophila_2:1627432_at:245:575; Interrogation_Position=762; Antisense; GGCGGACCCATGAGCTGCAACGGAA
>probe:Drosophila_2:1627432_at:229:367; Interrogation_Position=784; Antisense; GAATGTTGGCCGGAATCGTTTCGTA
>probe:Drosophila_2:1627432_at:453:237; Interrogation_Position=797; Antisense; AATCGTTTCGTACGGCGCTGGATGC
>probe:Drosophila_2:1627432_at:565:285; Interrogation_Position=829; Antisense; CTGGTTATCCGGGTGTCTACACAAA
>probe:Drosophila_2:1627432_at:390:109; Interrogation_Position=886; Antisense; AGAATAGCTCCCTCAACTATACCAT
>probe:Drosophila_2:1627432_at:568:411; Interrogation_Position=937; Antisense; GATCGAGTTGGTCCTACCTGGGCAT
>probe:Drosophila_2:1627432_at:91:563; Interrogation_Position=989; Antisense; GGAACTCTGAATCTAGTCATCGCAT

Paste this into a BLAST search page for me
GTCATCGCATAGGTCCGCCAAATAGACTGTAACGGCCCTGGCGTTGAACATGGCCACAAACACCGATTGCCTGATAGTAGTAATACTCTGCAGGCCGCGAGACGGTGCCCATAGTGTCGTATACAGTCGTATACAACCTGTCGCATTTCAATACAATTCGATTCCGGTTTCCCAGGGCGGACCCATGAGCTGCAACGGAAGAATGTTGGCCGGAATCGTTTCGTAAATCGTTTCGTACGGCGCTGGATGCCTGGTTATCCGGGTGTCTACACAAAAGAATAGCTCCCTCAACTATACCATGATCGAGTTGGTCCTACCTGGGCATGGAACTCTGAATCTAGTCATCGCAT

Full Affymetrix probeset data:

Annotations for 1627432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720