FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627433_at:

>probe:Drosophila_2:1627433_at:444:163; Interrogation_Position=1004; Antisense; AAATTATCGCACACAAGCTTCGCTC
>probe:Drosophila_2:1627433_at:459:207; Interrogation_Position=1018; Antisense; AAGCTTCGCTCCATGGACGGAACAC
>probe:Drosophila_2:1627433_at:418:561; Interrogation_Position=1036; Antisense; GGAACACAGGCTATCTACGCGGAAA
>probe:Drosophila_2:1627433_at:162:647; Interrogation_Position=1064; Antisense; TCATCGCCGATGTGCTGTACCAGGG
>probe:Drosophila_2:1627433_at:375:613; Interrogation_Position=1094; Antisense; TGAAAATGCTGTCCTCGCTGAGTAT
>probe:Drosophila_2:1627433_at:455:63; Interrogation_Position=1129; Antisense; ATGGGCGTGGACAATGCAACAGTTT
>probe:Drosophila_2:1627433_at:253:189; Interrogation_Position=1146; Antisense; AACAGTTTACCTAGAGAGCCACAGT
>probe:Drosophila_2:1627433_at:564:153; Interrogation_Position=1166; Antisense; ACAGTAAATGATGGCCTGGCCCCTT
>probe:Drosophila_2:1627433_at:669:499; Interrogation_Position=661; Antisense; GTCGAAATCGTGGTGCCTGCTAACA
>probe:Drosophila_2:1627433_at:604:453; Interrogation_Position=798; Antisense; GATCAGTAATCAGAGCCCGAGCCAG
>probe:Drosophila_2:1627433_at:116:291; Interrogation_Position=857; Antisense; CGGTCTCTTCGCAGATTTCGGAGGA
>probe:Drosophila_2:1627433_at:638:413; Interrogation_Position=886; Antisense; GAGCCGCCTCCAGGTAAATTCCGAG
>probe:Drosophila_2:1627433_at:638:555; Interrogation_Position=912; Antisense; GGACATTTCCACCATTGACTTTGAG
>probe:Drosophila_2:1627433_at:679:663; Interrogation_Position=956; Antisense; TAAAGAGTGCGGACAGCCAGCTGGA

Paste this into a BLAST search page for me
AAATTATCGCACACAAGCTTCGCTCAAGCTTCGCTCCATGGACGGAACACGGAACACAGGCTATCTACGCGGAAATCATCGCCGATGTGCTGTACCAGGGTGAAAATGCTGTCCTCGCTGAGTATATGGGCGTGGACAATGCAACAGTTTAACAGTTTACCTAGAGAGCCACAGTACAGTAAATGATGGCCTGGCCCCTTGTCGAAATCGTGGTGCCTGCTAACAGATCAGTAATCAGAGCCCGAGCCAGCGGTCTCTTCGCAGATTTCGGAGGAGAGCCGCCTCCAGGTAAATTCCGAGGGACATTTCCACCATTGACTTTGAGTAAAGAGTGCGGACAGCCAGCTGGA

Full Affymetrix probeset data:

Annotations for 1627433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720