FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627437_at:

>probe:Drosophila_2:1627437_at:12:305; Interrogation_Position=232; Antisense; CCGACTCTTGTCATGGTTTGCAATT
>probe:Drosophila_2:1627437_at:285:703; Interrogation_Position=324; Antisense; TTTTGTGCACTATGATCGCGATGGT
>probe:Drosophila_2:1627437_at:234:441; Interrogation_Position=343; Antisense; GATGGTAACTCATTGGGCACCGCTC
>probe:Drosophila_2:1627437_at:374:131; Interrogation_Position=361; Antisense; ACCGCTCACTTGTCGTTCAAATATC
>probe:Drosophila_2:1627437_at:468:375; Interrogation_Position=388; Antisense; GAAGAGGCCTTCCAGATCATCGAGC
>probe:Drosophila_2:1627437_at:441:453; Interrogation_Position=402; Antisense; GATCATCGAGCAGTTCCACGGAGTC
>probe:Drosophila_2:1627437_at:26:305; Interrogation_Position=426; Antisense; CCGTTTGGATGGACGCCGATTGAAA
>probe:Drosophila_2:1627437_at:130:61; Interrogation_Position=491; Antisense; ATGTCGATGATCTTTCCTTGCGGAT
>probe:Drosophila_2:1627437_at:500:721; Interrogation_Position=508; Antisense; TTGCGGATGGGTTCTTTCAAGACTC
>probe:Drosophila_2:1627437_at:10:489; Interrogation_Position=548; Antisense; GTACTTTTAAGACTCGTTCCTTGCA
>probe:Drosophila_2:1627437_at:125:109; Interrogation_Position=584; Antisense; AGAAGTCTCGTCTTTTTCGCAATAG
>probe:Drosophila_2:1627437_at:328:717; Interrogation_Position=599; Antisense; TTCGCAATAGTTCCTTCAAGCCTCG
>probe:Drosophila_2:1627437_at:711:649; Interrogation_Position=614; Antisense; TCAAGCCTCGTCCTTTCAAGAAACA
>probe:Drosophila_2:1627437_at:217:637; Interrogation_Position=651; Antisense; TCGAGCGTTCGATACTGATTTCTAA

Paste this into a BLAST search page for me
CCGACTCTTGTCATGGTTTGCAATTTTTTGTGCACTATGATCGCGATGGTGATGGTAACTCATTGGGCACCGCTCACCGCTCACTTGTCGTTCAAATATCGAAGAGGCCTTCCAGATCATCGAGCGATCATCGAGCAGTTCCACGGAGTCCCGTTTGGATGGACGCCGATTGAAAATGTCGATGATCTTTCCTTGCGGATTTGCGGATGGGTTCTTTCAAGACTCGTACTTTTAAGACTCGTTCCTTGCAAGAAGTCTCGTCTTTTTCGCAATAGTTCGCAATAGTTCCTTCAAGCCTCGTCAAGCCTCGTCCTTTCAAGAAACATCGAGCGTTCGATACTGATTTCTAA

Full Affymetrix probeset data:

Annotations for 1627437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720