FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627438_at:

>probe:Drosophila_2:1627438_at:595:263; Interrogation_Position=100; Antisense; CAGCTCTTGGCCGAAACAGTCATGG
>probe:Drosophila_2:1627438_at:670:611; Interrogation_Position=140; Antisense; TGAAGATGCCACGAACAGCTGTTTG
>probe:Drosophila_2:1627438_at:404:701; Interrogation_Position=167; Antisense; TTTTAGCCCTTAACCCGCTGCTTAT
>probe:Drosophila_2:1627438_at:69:343; Interrogation_Position=200; Antisense; GCTTTTTCCTCCCAGTTGATGCGGT
>probe:Drosophila_2:1627438_at:314:725; Interrogation_Position=215; Antisense; TTGATGCGGTGGCAACCTCAGGCAT
>probe:Drosophila_2:1627438_at:547:359; Interrogation_Position=226; Antisense; GCAACCTCAGGCATTGACTTTGGTA
>probe:Drosophila_2:1627438_at:490:403; Interrogation_Position=241; Antisense; GACTTTGGTAAAATTGTGGCACGCC
>probe:Drosophila_2:1627438_at:425:5; Interrogation_Position=253; Antisense; ATTGTGGCACGCCAAGCACATTTTG
>probe:Drosophila_2:1627438_at:26:93; Interrogation_Position=26; Antisense; AGTTTTGTGGGCACTCTCCGCGGAT
>probe:Drosophila_2:1627438_at:447:655; Interrogation_Position=289; Antisense; TAATACAGTTACACAGCGGGCCTCC
>probe:Drosophila_2:1627438_at:716:145; Interrogation_Position=367; Antisense; ACTCTGCTGCCGTTATTACACGATG
>probe:Drosophila_2:1627438_at:250:145; Interrogation_Position=38; Antisense; ACTCTCCGCGGATGGTGCGCTTTGC
>probe:Drosophila_2:1627438_at:66:625; Interrogation_Position=53; Antisense; TGCGCTTTGCGGTGCACTTGTTACC
>probe:Drosophila_2:1627438_at:59:147; Interrogation_Position=68; Antisense; ACTTGTTACCCTCCTTCTTGAATGG

Paste this into a BLAST search page for me
CAGCTCTTGGCCGAAACAGTCATGGTGAAGATGCCACGAACAGCTGTTTGTTTTAGCCCTTAACCCGCTGCTTATGCTTTTTCCTCCCAGTTGATGCGGTTTGATGCGGTGGCAACCTCAGGCATGCAACCTCAGGCATTGACTTTGGTAGACTTTGGTAAAATTGTGGCACGCCATTGTGGCACGCCAAGCACATTTTGAGTTTTGTGGGCACTCTCCGCGGATTAATACAGTTACACAGCGGGCCTCCACTCTGCTGCCGTTATTACACGATGACTCTCCGCGGATGGTGCGCTTTGCTGCGCTTTGCGGTGCACTTGTTACCACTTGTTACCCTCCTTCTTGAATGG

Full Affymetrix probeset data:

Annotations for 1627438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720