FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627439_at:

>probe:Drosophila_2:1627439_at:649:605; Interrogation_Position=516; Antisense; TGAGGTGACCTCGTCCCTACAAAAC
>probe:Drosophila_2:1627439_at:537:187; Interrogation_Position=538; Antisense; AACACCCAAGCGAATGCCAATGCCG
>probe:Drosophila_2:1627439_at:173:323; Interrogation_Position=583; Antisense; GCCCAATCGCAACTCAATCAGCTGA
>probe:Drosophila_2:1627439_at:623:375; Interrogation_Position=606; Antisense; GAAGAACCTTGTGATAGCCGCCACG
>probe:Drosophila_2:1627439_at:730:259; Interrogation_Position=627; Antisense; CACGTCCAATCTGGCCAATATCGAG
>probe:Drosophila_2:1627439_at:546:247; Interrogation_Position=642; Antisense; CAATATCGAGAACGTGGCCAGTGGA
>probe:Drosophila_2:1627439_at:96:295; Interrogation_Position=684; Antisense; CGAGAAGACGCAGCTCCTGGAGGCT
>probe:Drosophila_2:1627439_at:315:533; Interrogation_Position=720; Antisense; GGTGGAGAATCTAACCCGCCAGATG
>probe:Drosophila_2:1627439_at:317:35; Interrogation_Position=742; Antisense; ATGACCGAGGCCAAGACGGACTTCG
>probe:Drosophila_2:1627439_at:403:207; Interrogation_Position=775; Antisense; AAGCAGGCGGCCTACAAAGCGGCCT
>probe:Drosophila_2:1627439_at:221:159; Interrogation_Position=788; Antisense; ACAAAGCGGCCTGTGCTGCAGTGGA
>probe:Drosophila_2:1627439_at:99:111; Interrogation_Position=821; Antisense; AGAAGGCACAGAGGTCTCGTCGAAT
>probe:Drosophila_2:1627439_at:425:91; Interrogation_Position=893; Antisense; AGTTTTCCGGCGCAGGCAGCCAAAA
>probe:Drosophila_2:1627439_at:679:567; Interrogation_Position=907; Antisense; GGCAGCCAAAATCTAGCACCGAATT

Paste this into a BLAST search page for me
TGAGGTGACCTCGTCCCTACAAAACAACACCCAAGCGAATGCCAATGCCGGCCCAATCGCAACTCAATCAGCTGAGAAGAACCTTGTGATAGCCGCCACGCACGTCCAATCTGGCCAATATCGAGCAATATCGAGAACGTGGCCAGTGGACGAGAAGACGCAGCTCCTGGAGGCTGGTGGAGAATCTAACCCGCCAGATGATGACCGAGGCCAAGACGGACTTCGAAGCAGGCGGCCTACAAAGCGGCCTACAAAGCGGCCTGTGCTGCAGTGGAAGAAGGCACAGAGGTCTCGTCGAATAGTTTTCCGGCGCAGGCAGCCAAAAGGCAGCCAAAATCTAGCACCGAATT

Full Affymetrix probeset data:

Annotations for 1627439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720