FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627441_at:

>probe:Drosophila_2:1627441_at:285:363; Interrogation_Position=2791; Antisense; GAATTGTGGCAACTTTCGTGTTTCA
>probe:Drosophila_2:1627441_at:64:637; Interrogation_Position=2806; Antisense; TCGTGTTTCACCCTAAGCGTATGGA
>probe:Drosophila_2:1627441_at:648:163; Interrogation_Position=2856; Antisense; AAATCTGCGCTCAAGATATGTAAGC
>probe:Drosophila_2:1627441_at:627:389; Interrogation_Position=2911; Antisense; GAGAAACGTTTTCTAGGCATTACTT
>probe:Drosophila_2:1627441_at:413:195; Interrogation_Position=2973; Antisense; AACGATAAACCACTATACCTAATGT
>probe:Drosophila_2:1627441_at:151:483; Interrogation_Position=2996; Antisense; GTATACTTTCAAATACGCTTTGGAC
>probe:Drosophila_2:1627441_at:516:27; Interrogation_Position=3008; Antisense; ATACGCTTTGGACTATTTGTTAAAT
>probe:Drosophila_2:1627441_at:655:277; Interrogation_Position=3067; Antisense; CTATTGTGTTGAGTGGGCAGCTTAA
>probe:Drosophila_2:1627441_at:680:567; Interrogation_Position=3082; Antisense; GGCAGCTTAAAGCTAGCACATCGAA
>probe:Drosophila_2:1627441_at:317:339; Interrogation_Position=3093; Antisense; GCTAGCACATCGAAACTTACTTAAG
>probe:Drosophila_2:1627441_at:453:455; Interrogation_Position=3121; Antisense; GATAAATGTTTAACTGCACGTTACG
>probe:Drosophila_2:1627441_at:35:355; Interrogation_Position=3136; Antisense; GCACGTTACGAAATGCAACAGAGTT
>probe:Drosophila_2:1627441_at:17:475; Interrogation_Position=3188; Antisense; GTTAACTCAAGTACATGCTATATCG
>probe:Drosophila_2:1627441_at:265:137; Interrogation_Position=3242; Antisense; ACGACGATGTACGATAGTTTCACTA

Paste this into a BLAST search page for me
GAATTGTGGCAACTTTCGTGTTTCATCGTGTTTCACCCTAAGCGTATGGAAAATCTGCGCTCAAGATATGTAAGCGAGAAACGTTTTCTAGGCATTACTTAACGATAAACCACTATACCTAATGTGTATACTTTCAAATACGCTTTGGACATACGCTTTGGACTATTTGTTAAATCTATTGTGTTGAGTGGGCAGCTTAAGGCAGCTTAAAGCTAGCACATCGAAGCTAGCACATCGAAACTTACTTAAGGATAAATGTTTAACTGCACGTTACGGCACGTTACGAAATGCAACAGAGTTGTTAACTCAAGTACATGCTATATCGACGACGATGTACGATAGTTTCACTA

Full Affymetrix probeset data:

Annotations for 1627441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720